Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp04

Orthogroup ID

OG0002418

Physical Location & Seq

Genomic Coordinates Reverse (-)

12646617 .. 12649114

Gene Structure 2498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.4G203400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1152 bp

ATGGAAGCGCTCCTAAGATTCAAACAGCAGCTAATCAAAGAAGCTGACCACCAAGGAAAGACTCCTCTTTACTATGCAGCATCCCTTGGAGACCATAGAACAGTAGAACGATTACTAGTACTCGACATTTCGATAGCATATGTTTTGGATAAACAGGGTTTCTCACCAATTCATGTTGCAGCCAGCAAAGGTCATACCAGTGTGATTAGAGAGATTGTTCGACATTGCCCAGATTCGGGAGAACTTGTTGATCCTTACGGATGGAATGCCCTTCATATTGCAATCTTCAATGGGCAAGCAAACGTTGTCAGATATATACTAGAAACAGCAGAGCTGGAGGGGACCATAAACCAGCCTGATTTTGATGGAAATACGCCTTTGCATCTAGCCACCATTGAAAGAAAAACTTGGATTCTGAGATACTTGAGGTGGGATGGAAGAGTAAATTTAAGATCCAAGAACAAATTTGGCCAAACAGCAATTGAGATTGATAGGTCAATCAAAGAATCTAGTATTACATCTCCCAGGGAATTGCAGAACATAACTCCAAGCATTTGGGGACATCTCGGTACCCAACATTCATGGTTGGGCAACATCAAGATATCCCCAAGAGCAGAACAAGAAGAAGCCAATGCAGTGCAAACTTACATGCAAATGGGGCAGACCCTGTTGATGGTTGCAACACTTATCACAACTGTAACATTTGCAGCTGCCTTCACAATGCCTGGGGGGTATAACAATGATGTAGGCCCAGACCGAGGGCAGGCTCTTCTGCAGTCAAATAATGATTTCAAGTGGTTCATCATCACAGACACTGTTGCCATGACTTGCTCAATAATTGCTGCTTGCCTTCTGTTTTGGGGAGCTGTCAACAGCAACAAGTCCTCCTATGTTTACTATTTCACAAGTGCTGCTGCTCTTACATATATTGCTCTGCAATCCACCGCAATAGCATTCGAAACAGGGATTAAGGCTGCCATGCCTGATCAGCAATGTCTCAAAACCTTGGGAACCCTAGTCGGAGCGGCTTTTCATGTTATTACCTTCTTGGCTCTTTCCCAGTTGGTGAAAATGTTTTCCCTACCTGAAGCCTGCAGATTCTTCATTTCTCATCTTTGTAAGCTCAAGTGCAAAATCAAGAACAAACCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_3 Ank_4 Ank_5 PGG

Protein Analysis

384

Amino Acids

42.65

Weight (kDa)

8.57

Isoelectric Point (pI)

40.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002418)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03495
malus_domestica	MD11G1226900.v1.1
prunus_persica	Prupe.4G202700_v2.0.a1 Prupe.4G202800_v2.0.a1 Prupe.4G202900_v2.0.a1 Prupe.4G203100_v2.0.a1 Prupe.4G203300_v2.0.a1 Prupe.4G203400_v2.0.a1 Prupe.4G203500_v2.0.a1 Prupe.4G203600_v2.0.a1 Prupe.4G203600_v2.0.a1 Prupe.4G203800_v2.0.a1 Prupe.4G204100_v2.0.a1
pyrus_communis	pycom11g19940
rosa_chinensis	RchiOBHm_Chr4g0410171 RchiOBHm_Chr5g0037621
rosa_laevigata	RLG00000008451 RLG00000023471 RLG00000033790 RLG00000033795
rosa_multiflora	Rmu_sc0000365.1_g000031 Rmu_sc0002521.1_g000047 Rmu_sc0006558.1_g000005 Rmu_sc0006558.1_g000006
rosa_roxburghii	Rroxscaffold_1G00043350 Rroxscaffold_1G00043410 Rroxscaffold_1G00043420 Rroxscaffold_1G00043530 Rroxscaffold_5G00354960
rosa_rugosa	Rorug05G0165700 Rorug05G0165900
rosa_samantha	Rh4CG171100 Rh4CG171200 Rh5AG255200 Rh5BG256700 Rh5BG257000 Rh5DG265200 Rh5DG265300 Rh5DG265400 Rh5DG266000
rosa_wichuraiana	Rw5G023650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	569
AccB1I	GGYRCC	1 cut(s)	569
AccBSI	CCGCTC	1 cut(s)	1025
AciI	CCGC	2 cut(s)	945, 1025
AclI	AACGTT	1 cut(s)	303
AclWI	GGATC	2 cut(s)	245, 447
AcoI	YGGCCR	1 cut(s)	469
AcsI	RAATTY	2 cut(s)	445, 464
AcuI	CTGAAG	1 cut(s)	1107
AfaI	GTAC	2 cut(s)	120, 571
AfeI	AGCGCT	1 cut(s)	9
AfiI	CCNNNNNNNGG	5 cut(s)	235, 236, 673, 758, 763
AgsI	TTSAA	4 cut(s)	22, 289, 398, 793
AhlI	ACTAGT	1 cut(s)	115
AjnI	CCWGG	2 cut(s)	524, 724
AluBI	AGCT	6 cut(s)	31, 44, 334, 710, 866, 1123
AluI	AGCT	6 cut(s)	31, 44, 334, 710, 866, 1123
Alw26I	GTCTC	2 cut(s)	84, 1001
AlwI	GGATC	2 cut(s)	245, 447
AlwNI	CAGNNNCTG	2 cut(s)	667, 815
Aor51HI	AGCGCT	1 cut(s)	9
AoxI	GGCC	2 cut(s)	469, 748
ApeKI	GCWGC	9 cut(s)	28, 77, 179, 707, 710, 842, 911, 914, 974
ApoI	RAATTY	2 cut(s)	445, 464
Asp718I	GGTACC	1 cut(s)	569
AspLEI	GCGC	1 cut(s)	10
AspS9I	GGNCC	2 cut(s)	342, 749
AsuHPI	GGTGA	2 cut(s)	156, 1078
AsuII	TTCGAA	1 cut(s)	957
AvaII	GGWCC	1 cut(s)	342
BalI	TGGCCA	1 cut(s)	471
BanI	GGYRCC	1 cut(s)	569
BbvI	GCAGC	9 cut(s)	40, 89, 191, 697, 719, 829, 898, 901, 961
BccI	CCATC	4 cut(s)	255, 359, 428, 667
BciT130I	CCWGG	2 cut(s)	526, 726
BclI	TGATCA	1 cut(s)	985
BcoDI	GTCTC	2 cut(s)	84, 1001
BcuI	ACTAGT	1 cut(s)	115
BfaI	CTAG	5 cut(s)	116, 320, 386, 510, 1016
BfmI	CTRYAG	2 cut(s)	773, 1093
BfoI	RGCGCY	1 cut(s)	11
BmcAI	AGTACT	1 cut(s)	120
Bme1390I	CCNGG	2 cut(s)	526, 726
Bme18I	GGWCC	1 cut(s)	342
BmgT120I	GGNCC	2 cut(s)	342, 749
BmiI	GGNNCC	3 cut(s)	343, 571, 1012
BmrFI	CCNGG	2 cut(s)	526, 726
BmrI	ACTGGG	1 cut(s)	1054
BmsI	GCATC	2 cut(s)	89, 391
BmuI	ACTGGG	1 cut(s)	1054
BpmI	CTGGAG	1 cut(s)	356
Bpu14I	TTCGAA	1 cut(s)	957
BpuEI	CTTGAG	2 cut(s)	445, 1109
BsaI	GGTCTC	1 cut(s)	84
BsaJI	CCNNGG	7 cut(s)	52, 85, 524, 525, 725, 757, 1005
BsaXI	ACNNNNNCTCC	4 cut(s)	231, 261, 869, 899
Bsc4I	CCNNNNNNNGG	5 cut(s)	235, 236, 673, 758, 763
Bse1I	ACTGG	2 cut(s)	198, 1060
Bse3DI	GCAATG	2 cut(s)	223, 998
BseBI	CCWGG	2 cut(s)	526, 726
BseDI	CCNNGG	7 cut(s)	52, 85, 524, 525, 725, 757, 1005
BseGI	GGATG	3 cut(s)	80, 266, 439
BseLI	CCNNNNNNNGG	5 cut(s)	235, 236, 673, 758, 763
BseMI	GCAATG	2 cut(s)	223, 998
BseMII	CTCAG	1 cut(s)	407
BseNI	ACTGG	2 cut(s)	198, 1060
BseRI	GAGGAG	1 cut(s)	54
BseXI	GCAGC	9 cut(s)	40, 89, 191, 697, 719, 829, 898, 901, 961
BshFI	GGCC	2 cut(s)	471, 750
BshNI	GGYRCC	1 cut(s)	569
BslFI	GGGAC	2 cut(s)	355, 573
BslI	CCNNNNNNNGG	5 cut(s)	235, 236, 673, 758, 763
BsmAI	GTCTC	2 cut(s)	84, 1001
BsmFI	GGGAC	2 cut(s)	355, 573
BsmI	GAATGC	2 cut(s)	271, 953
BsnI	GGCC	2 cut(s)	471, 750
Bso31I	GGTCTC	1 cut(s)	84
Bsp119I	TTCGAA	1 cut(s)	957
Bsp143I	GATC	3 cut(s)	250, 452, 985
BspACI	CCGC	2 cut(s)	945, 1025
BspANI	GGCC	2 cut(s)	471, 750
BspCNI	CTCAG	1 cut(s)	408
BspLI	GGNNCC	3 cut(s)	343, 571, 1012
BspMAI	CTGCAG	2 cut(s)	777, 1097
BspPI	GGATC	2 cut(s)	245, 447
BspQI	GCTCTTC	1 cut(s)	774
BspT104I	TTCGAA	1 cut(s)	957
BspT107I	GGYRCC	1 cut(s)	569
BspTNI	GGTCTC	1 cut(s)	84
BsrBI	CCGCTC	1 cut(s)	1025
BsrDI	GCAATG	2 cut(s)	223, 998
BsrI	ACTGG	2 cut(s)	198, 1060
BssECI	CCNNGG	7 cut(s)	52, 85, 524, 525, 725, 757, 1005
BssMI	GATC	3 cut(s)	250, 452, 985
BssT1I	CCWWGG	3 cut(s)	52, 85, 1005
Bst2UI	CCWGG	2 cut(s)	526, 726
Bst4CI	ACNGT	3 cut(s)	103, 697, 817
Bst6I	CTCTTC	2 cut(s)	433, 774
BstBI	TTCGAA	1 cut(s)	957
BstC8I	GCNNGC	5 cut(s)	184, 297, 765, 847, 1093
BstDEI	CTNAG	2 cut(s)	14, 416
BstF5I	GGATG	3 cut(s)	80, 266, 439
BstH2I	RGCGCY	1 cut(s)	11
BstHHI	GCGC	1 cut(s)	10
BstKTI	GATC	3 cut(s)	253, 455, 988
BstMAI	GTCTC	2 cut(s)	84, 1001
BstMBI	GATC	3 cut(s)	250, 452, 985
BstMWI	GCNNNNNNNGC	2 cut(s)	658, 988
BstNI	CCWGG	2 cut(s)	526, 726
BstNSI	RCATGY	1 cut(s)	652
BstSCI	CCNGG	2 cut(s)	524, 724
BstSFI	CTRYAG	2 cut(s)	773, 1093
BstV1I	GCAGC	9 cut(s)	40, 89, 191, 697, 719, 829, 898, 901, 961
BstX2I	RGATCY	1 cut(s)	452
BstXI	CCANNNNNNTGG	1 cut(s)	555
BstYI	RGATCY	1 cut(s)	452
BsuRI	GGCC	2 cut(s)	471, 750
BtsCI	GGATG	3 cut(s)	80, 266, 439
BtsI	GCAGTG	1 cut(s)	642
BtsIMutI	CAGTG	3 cut(s)	205, 642, 813
Cac8I	GCNNGC	5 cut(s)	184, 297, 765, 847, 1093
CaiI	CAGNNNCTG	2 cut(s)	667, 815
CfoI	GCGC	1 cut(s)	10
Cfr13I	GGNCC	2 cut(s)	342, 749
Csp6I	GTAC	2 cut(s)	119, 570
CviAII	CATG	7 cut(s)	173, 582, 649, 823, 979, 1034, 1149
CviQI	GTAC	2 cut(s)	119, 570
DdeI	CTNAG	2 cut(s)	14, 416
DpnI	GATC	3 cut(s)	252, 454, 987
DpnII	GATC	3 cut(s)	250, 452, 985
EaeI	YGGCCR	1 cut(s)	469
Eam1104I	CTCTTC	2 cut(s)	433, 774
EarI	CTCTTC	2 cut(s)	433, 774
Eco130I	CCWWGG	3 cut(s)	52, 85, 1005
Eco31I	GGTCTC	1 cut(s)	84
Eco32I	GATATC	1 cut(s)	603
Eco47I	GGWCC	1 cut(s)	342
Eco47III	AGCGCT	1 cut(s)	9
Eco57I	CTGAAG	1 cut(s)	1107
EcoRII	CCWGG	2 cut(s)	524, 724
EcoRV	GATATC	1 cut(s)	603
EcoT14I	CCWWGG	3 cut(s)	52, 85, 1005
ErhI	CCWWGG	3 cut(s)	52, 85, 1005
FaeI	CATG	7 cut(s)	176, 585, 652, 826, 982, 1037, 1152
FalI	AAGNNNNNCTT	2 cut(s)	391, 423
FaqI	GGGAC	2 cut(s)	355, 573
FatI	CATG	7 cut(s)	172, 581, 648, 822, 978, 1033, 1148
FauNDI	CATATG	1 cut(s)	139
FbaI	TGATCA	1 cut(s)	985
FokI	GGATG	3 cut(s)	67, 273, 446
FspBI	CTAG	5 cut(s)	116, 320, 386, 510, 1016
GlaI	GCGC	1 cut(s)	9
GsuI	CTGGAG	1 cut(s)	356
HaeII	RGCGCY	1 cut(s)	11
HaeIII	GGCC	2 cut(s)	471, 750
HhaI	GCGC	1 cut(s)	10
Hin1II	CATG	7 cut(s)	176, 585, 652, 826, 982, 1037, 1152
Hin6I	GCGC	1 cut(s)	8
HinP1I	GCGC	1 cut(s)	8
HincII	GTYRAC	1 cut(s)	871
HindII	GTYRAC	1 cut(s)	871
HinfI	GANTC	6 cut(s)	18, 61, 233, 412, 506, 1098
HphI	GGTGA	2 cut(s)	156, 1078
Hpy166II	GTNNAC	2 cut(s)	871, 895
Hpy188I	TCNGA	3 cut(s)	311, 417, 1022
Hpy188III	TCNNGA	3 cut(s)	237, 598, 1138
Hpy8I	GTNNAC	2 cut(s)	871, 895
HpyAV	CCTTC	4 cut(s)	281, 724, 860, 1054
HpyCH4III	ACNGT	3 cut(s)	103, 697, 817
HpyCH4IV	ACGT	1 cut(s)	303
HpyF10VI	GCNNNNNNNGC	2 cut(s)	658, 988
HpyF3I	CTNAG	2 cut(s)	14, 416
HpySE526I	ACGT	1 cut(s)	303
Hsp92II	CATG	7 cut(s)	176, 585, 652, 826, 982, 1037, 1152
HspAI	GCGC	1 cut(s)	8
KpnI	GGTACC	1 cut(s)	573
Ksp22I	TGATCA	1 cut(s)	985
Kzo9I	GATC	3 cut(s)	250, 452, 985
LguI	GCTCTTC	1 cut(s)	774
LmnI	GCTCC	3 cut(s)	15, 863, 1022
Lsp1109I	GCAGC	9 cut(s)	40, 89, 191, 697, 719, 829, 898, 901, 961
LweI	GCATC	2 cut(s)	89, 391
MaeI	CTAG	5 cut(s)	116, 320, 386, 510, 1016
MaeII	ACGT	1 cut(s)	303
MaeIII	GTNAC	1 cut(s)	697
MalI	GATC	3 cut(s)	252, 454, 987
MbiI	CCGCTC	1 cut(s)	1025
MboI	GATC	3 cut(s)	250, 452, 985
MboII	GAAGA	5 cut(s)	277, 450, 635, 761, 1093
MfeI	CAATTG	1 cut(s)	480
MflI	RGATCY	1 cut(s)	452
MlsI	TGGCCA	1 cut(s)	471
MluCI	AATT	6 cut(s)	168, 445, 464, 480, 530, 837
MluNI	TGGCCA	1 cut(s)	471
MlyI	GAGTC	1 cut(s)	55
MmeI	TCCRAC	1 cut(s)	1000
MnlI	CCTC	5 cut(s)	75, 331, 420, 752, 895
Mox20I	TGGCCA	1 cut(s)	471
MscI	TGGCCA	1 cut(s)	471
MseI	TTAA	2 cut(s)	449, 969
MslI	CAYNNNNRTG	2 cut(s)	198, 653
Msp20I	TGGCCA	1 cut(s)	471
MspA1I	CMGCKG	1 cut(s)	710
MspR9I	CCNGG	2 cut(s)	526, 726
MunI	CAATTG	1 cut(s)	480
Mva1269I	GAATGC	2 cut(s)	271, 953
MvaI	CCWGG	2 cut(s)	526, 726
MwoI	GCNNNNNNNGC	2 cut(s)	658, 988
NdeI	CATATG	1 cut(s)	139
NdeII	GATC	3 cut(s)	250, 452, 985
NlaIII	CATG	7 cut(s)	176, 585, 652, 826, 982, 1037, 1152
NlaIV	GGNNCC	3 cut(s)	343, 571, 1012
NspI	RCATGY	1 cut(s)	652
NspV	TTCGAA	1 cut(s)	957
PasI	CCCWGGG	1 cut(s)	525
PciSI	GCTCTTC	1 cut(s)	774
PctI	GAATGC	2 cut(s)	271, 953
PfeI	GAWTC	5 cut(s)	18, 233, 412, 506, 1098
PleI	GAGTC	1 cut(s)	55
PpsI	GAGTC	1 cut(s)	55
Psp1406I	AACGTT	1 cut(s)	303
Psp6I	CCWGG	2 cut(s)	524, 724
PspGI	CCWGG	2 cut(s)	524, 724
PspN4I	GGNNCC	3 cut(s)	343, 571, 1012
PspPI	GGNCC	2 cut(s)	342, 749
PstI	CTGCAG	2 cut(s)	777, 1097
PstNI	CAGNNNCTG	2 cut(s)	667, 815
PsuI	RGATCY	1 cut(s)	452
PvuII	CAGCTG	1 cut(s)	710
RsaI	GTAC	2 cut(s)	120, 571
RsaNI	GTAC	2 cut(s)	119, 570
RseI	CAYNNNNRTG	2 cut(s)	198, 653
SapI	GCTCTTC	1 cut(s)	774
SaqAI	TTAA	2 cut(s)	449, 969
Sau3AI	GATC	3 cut(s)	250, 452, 985
Sau96I	GGNCC	2 cut(s)	342, 749
ScaI	AGTACT	1 cut(s)	120
SchI	GAGTC	1 cut(s)	55
ScrFI	CCNGG	2 cut(s)	526, 726
SfaNI	GCATC	2 cut(s)	89, 391
SfcI	CTRYAG	2 cut(s)	773, 1093
SfuI	TTCGAA	1 cut(s)	957
SinI	GGWCC	1 cut(s)	342
SmiMI	CAYNNNNRTG	2 cut(s)	198, 653
SmlI	CTYRAG	2 cut(s)	424, 1124
SmoI	CTYRAG	2 cut(s)	424, 1124
SpeI	ACTAGT	1 cut(s)	115
Sse9I	AATT	6 cut(s)	168, 445, 464, 480, 530, 837
SsiI	CCGC	2 cut(s)	945, 1025
SspMI	CTAG	5 cut(s)	116, 320, 386, 510, 1016
StyD4I	CCNGG	2 cut(s)	524, 724
StyI	CCWWGG	3 cut(s)	52, 85, 1005
TaaI	ACNGT	3 cut(s)	103, 697, 817
TaiI	ACGT	1 cut(s)	306
TaqI	TCGA	4 cut(s)	123, 131, 220, 957
TaqII	GACCGA	1 cut(s)	771
TasI	AATT	6 cut(s)	168, 445, 464, 480, 530, 837
TatI	WGTACW	1 cut(s)	118
TauI	GCSGC	1 cut(s)	1028
TfiI	GAWTC	5 cut(s)	18, 233, 412, 506, 1098
Tru1I	TTAA	2 cut(s)	449, 969
Tru9I	TTAA	2 cut(s)	449, 969
TscAI	CASTG	3 cut(s)	205, 642, 820
TseI	GCWGC	9 cut(s)	28, 77, 179, 707, 710, 842, 911, 914, 974
TspDTI	ATGAA	6 cut(s)	161, 263, 570, 790, 1022, 1093
TspGWI	ACGGA	1 cut(s)	273
TspRI	CASTG	3 cut(s)	205, 642, 820
VpaK11BI	GGWCC	1 cut(s)	342
XapI	RAATTY	2 cut(s)	445, 464
XceI	RCATGY	1 cut(s)	652
XspI	CTAG	5 cut(s)	116, 320, 386, 510, 1016
ZrmI	AGTACT	1 cut(s)	120

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.