Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006558.1

Orthogroup ID

OG0002418

Physical Location & Seq

Genomic Coordinates Reverse (-)

26319 .. 27702

Gene Structure 1384 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006558.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1119 bp

atggaagctctggtagcattcaaacaagaacttgccaaagaagctgatcgacaaggccggactcctctctactatgcagcatccctaggtgaccacagaacagttaagcgattactagaacttgatacttctactgcatatgttttggataaaggtggtcgttcaccaattcatgttgcagctaggaatggtcataccggtgtgattagagagattatccaacattgcccagattcgggagaacttattgacccttatggacagaatgctcttcatattgctatttccagtggacaagctaatgttgtcacatatatattagaaacaccagaactagaagggttgataaatcagtctgatattgatggaaacacccctttgcatctagcggcgattgcgagaaaaacttggattctttggtacttgatgtgggatggaagagtaaatcaaagatccaagaacaaatatggccaaacagcatttgacagtgatagatcaattaaagaatctagtattacatcttccatgatttcagcaagagcggaccacgaagaagcaatttcagcaatgcaaacttacaagaaaatgggtcagacccttttaatggttgcaacactcattacaactgtaacatttacagcagtattcacaatgcctggaggctacaacaatgatgcaggctcatcagaccgagggctggctcttctgcagtcgagcgaaaatctaaaaagtttcattgtctcagacactgttgctatgacttgctcaattagtgcagcttgcctcctattttggggagctgttaacagcaaggagtgctatctttactatttcacaagtgccgctgctcttacatatattgctctacaatcgactgcaatagcattcacaacaggaattagagctgtgctgccccatcagcaattcgtgcataccatgggactgggagtggaggttgcttttcacatcagtaccttcttgtttctctctcaattggttaaaacgttttccatccctgaagcctgtagactcttgttttctcatctccgtatcaagtccaaaagggctaagagagaaaagtggagaaatacatgtttgaagttgtgcttggcctcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank Ank_2 Ank_3 Ank_4 Ank_5 PGG

Protein Analysis

372

Amino Acids

41.08

Weight (kDa)

8.73

Isoelectric Point (pI)

39.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002418)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G03495
malus_domestica	MD11G1226900.v1.1
prunus_persica	Prupe.4G202700_v2.0.a1 Prupe.4G202800_v2.0.a1 Prupe.4G202900_v2.0.a1 Prupe.4G203100_v2.0.a1 Prupe.4G203300_v2.0.a1 Prupe.4G203400_v2.0.a1 Prupe.4G203500_v2.0.a1 Prupe.4G203600_v2.0.a1 Prupe.4G203600_v2.0.a1 Prupe.4G203800_v2.0.a1 Prupe.4G204100_v2.0.a1
pyrus_communis	pycom11g19940
rosa_chinensis	RchiOBHm_Chr4g0410171 RchiOBHm_Chr5g0037621
rosa_laevigata	RLG00000008451 RLG00000023471 RLG00000033790 RLG00000033795
rosa_multiflora	Rmu_sc0000365.1_g000031 Rmu_sc0002521.1_g000047 Rmu_sc0006558.1_g000005 Rmu_sc0006558.1_g000006
rosa_roxburghii	Rroxscaffold_1G00043350 Rroxscaffold_1G00043410 Rroxscaffold_1G00043420 Rroxscaffold_1G00043530 Rroxscaffold_5G00354960
rosa_rugosa	Rorug05G0165700 Rorug05G0165900
rosa_samantha	Rh4CG171100 Rh4CG171200 Rh5AG255200 Rh5BG256700 Rh5BG257000 Rh5DG265200 Rh5DG265300 Rh5DG265400 Rh5DG266000
rosa_wichuraiana	Rw5G023650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	542
AccI	GTMKAC	1 cut(s)	1027
AciI	CCGC	3 cut(s)	389, 542, 843
AclI	AACGTT	1 cut(s)	1004
AclWI	GGATC	1 cut(s)	447
AcoI	YGGCCR	1 cut(s)	469
AcuI	CTGAAG	1 cut(s)	1038
AfaI	GTAC	2 cut(s)	422, 973
AfiI	CCNNNNNNNGG	5 cut(s)	235, 236, 604, 697, 793
AflIII	ACRYGT	1 cut(s)	1091
AgeI	ACCGGT	1 cut(s)	197
AgsI	TTSAA	2 cut(s)	22, 1099
AjnI	CCWGG	1 cut(s)	655
AjuI	GAANNNNNNNTTGG	1 cut(s)	1091
AluBI	AGCT	7 cut(s)	8, 44, 182, 299, 779, 800, 905
AluI	AGCT	7 cut(s)	8, 44, 182, 299, 779, 800, 905
Alw26I	GTCTC	1 cut(s)	745
AlwI	GGATC	1 cut(s)	447
AlwNI	CAGNNNCTG	1 cut(s)	749
AoxI	GGCC	3 cut(s)	55, 469, 1110
ApeKI	GCWGC	5 cut(s)	77, 179, 776, 845, 910
AsiGI	ACCGGT	1 cut(s)	197
AspA2I	CCTAGG	1 cut(s)	85
AspS9I	GGNCC	1 cut(s)	544
AsuHPI	GGTGA	2 cut(s)	101, 156
AvaII	GGWCC	1 cut(s)	544
AvrII	CCTAGG	1 cut(s)	85
BaeI	ACNNNNGTAYC	2 cut(s)	955, 988
BalI	TGGCCA	1 cut(s)	471
BarI	GAAGNNNNNNTAC	2 cut(s)	505, 537
BbvI	GCAGC	5 cut(s)	89, 191, 788, 832, 897
BccI	CCATC	4 cut(s)	359, 428, 924, 1019
BciT130I	CCWGG	1 cut(s)	657
BcoDI	GTCTC	1 cut(s)	745
BfaI	CTAG	6 cut(s)	86, 116, 183, 335, 386, 510
BfmI	CTRYAG	2 cut(s)	707, 1024
BisI	GCNGC	7 cut(s)	78, 180, 390, 777, 843, 846, 911
BlnI	CCTAGG	1 cut(s)	85
BlsI	GCNGC	7 cut(s)	79, 181, 391, 778, 844, 847, 912
Bme1390I	CCNGG	1 cut(s)	657
Bme18I	GGWCC	1 cut(s)	544
BmgT120I	GGNCC	1 cut(s)	544
BmrFI	CCNGG	1 cut(s)	657
BmrI	ACTGGG	1 cut(s)	953
BmsI	GCATC	3 cut(s)	89, 391, 664
BmuI	ACTGGG	1 cut(s)	953
BpmI	CTGGAG	1 cut(s)	678
BsaJI	CCNNGG	3 cut(s)	85, 691, 936
BsaWI	WCCGGW	1 cut(s)	197
BsaXI	ACNNNNNCTCC	2 cut(s)	939, 969
Bsc4I	CCNNNNNNNGG	5 cut(s)	235, 236, 604, 697, 793
Bse118I	RCCGGY	1 cut(s)	197
Bse1I	ACTGG	2 cut(s)	288, 948
Bse3DI	GCAATG	2 cut(s)	223, 573
BseBI	CCWGG	1 cut(s)	657
BseDI	CCNNGG	3 cut(s)	85, 691, 936
BseGI	GGATG	3 cut(s)	80, 439, 1011
BseLI	CCNNNNNNNGG	5 cut(s)	235, 236, 604, 697, 793
BseMI	GCAATG	2 cut(s)	223, 573
BseMII	CTCAG	1 cut(s)	756
BseNI	ACTGG	2 cut(s)	288, 948
BseRI	GAGGAG	1 cut(s)	54
BseXI	GCAGC	5 cut(s)	89, 191, 788, 832, 897
BsgI	GTGCAG	1 cut(s)	795
BshFI	GGCC	3 cut(s)	57, 471, 1112
BshTI	ACCGGT	1 cut(s)	197
BsiSI	CCGG	2 cut(s)	58, 198
BslFI	GGGAC	1 cut(s)	954
BslI	CCNNNNNNNGG	5 cut(s)	235, 236, 604, 697, 793
BsmAI	GTCTC	1 cut(s)	745
BsmFI	GGGAC	1 cut(s)	954
BsmI	GAATGC	3 cut(s)	17, 271, 884
BsnI	GGCC	3 cut(s)	57, 471, 1112
Bsp143I	GATC	3 cut(s)	46, 452, 494
Bsp19I	CCATGG	1 cut(s)	936
BspACI	CCGC	3 cut(s)	389, 542, 843
BspANI	GGCC	3 cut(s)	57, 471, 1112
BspCNI	CTCAG	1 cut(s)	755
BspHI	TCATGA	1 cut(s)	1115
BspMAI	CTGCAG	1 cut(s)	711
BspPI	GGATC	1 cut(s)	447
BspQI	GCTCTTC	2 cut(s)	276, 708
BsrBI	CCGCTC	1 cut(s)	542
BsrDI	GCAATG	2 cut(s)	223, 573
BsrFI	RCCGGY	1 cut(s)	197
BsrI	ACTGG	2 cut(s)	288, 948
BssAI	RCCGGY	1 cut(s)	197
BssECI	CCNNGG	3 cut(s)	85, 691, 936
BssMI	GATC	3 cut(s)	46, 452, 494
BssT1I	CCWWGG	2 cut(s)	85, 936
Bst2UI	CCWGG	1 cut(s)	657
Bst4CI	ACNGT	4 cut(s)	103, 488, 628, 751
Bst6I	CTCTTC	3 cut(s)	276, 433, 708
BstAPI	GCANNNNNTGC	2 cut(s)	816, 928
BstC8I	GCNNGC	3 cut(s)	679, 699, 781
BstDEI	CTNAG	2 cut(s)	742, 1068
BstDSI	CCRYGG	1 cut(s)	936
BstEII	GGTNACC	1 cut(s)	89
BstF5I	GGATG	3 cut(s)	80, 439, 1011
BstKTI	GATC	3 cut(s)	49, 455, 497
BstMAI	GTCTC	1 cut(s)	745
BstMBI	GATC	3 cut(s)	46, 452, 494
BstMWI	GCNNNNNNNGC	7 cut(s)	14, 41, 395, 563, 816, 919, 928
BstNI	CCWGG	1 cut(s)	657
BstNSI	RCATGY	1 cut(s)	1095
BstPI	GGTNACC	1 cut(s)	89
BstSCI	CCNGG	1 cut(s)	655
BstSFI	CTRYAG	2 cut(s)	707, 1024
BstV1I	GCAGC	5 cut(s)	89, 191, 788, 832, 897
BstX2I	RGATCY	1 cut(s)	452
BstXI	CCANNNNNNTGG	1 cut(s)	943
BstYI	RGATCY	1 cut(s)	452
BsuRI	GGCC	3 cut(s)	57, 471, 1112
BtgI	CCRYGG	1 cut(s)	936
BtsCI	GGATG	3 cut(s)	80, 439, 1011
BtsIMutI	CAGTG	3 cut(s)	295, 493, 747
Cac8I	GCNNGC	3 cut(s)	679, 699, 781
CaiI	CAGNNNCTG	1 cut(s)	749
CciI	TCATGA	1 cut(s)	1115
Cfr10I	RCCGGY	1 cut(s)	197
Cfr13I	GGNCC	1 cut(s)	544
Csp6I	GTAC	2 cut(s)	421, 972
CspAI	ACCGGT	1 cut(s)	197
CviAII	CATG	5 cut(s)	173, 526, 937, 1092, 1116
CviQI	GTAC	2 cut(s)	421, 972
DdeI	CTNAG	2 cut(s)	742, 1068
DpnI	GATC	3 cut(s)	48, 454, 496
DpnII	GATC	3 cut(s)	46, 452, 494
EaeI	YGGCCR	1 cut(s)	469
Eam1104I	CTCTTC	3 cut(s)	276, 433, 708
EarI	CTCTTC	3 cut(s)	276, 433, 708
Eco130I	CCWWGG	2 cut(s)	85, 936
Eco47I	GGWCC	1 cut(s)	544
Eco57I	CTGAAG	1 cut(s)	1038
Eco91I	GGTNACC	1 cut(s)	89
EcoO65I	GGTNACC	1 cut(s)	89
EcoRII	CCWGG	1 cut(s)	655
EcoT14I	CCWWGG	2 cut(s)	85, 936
ErhI	CCWWGG	2 cut(s)	85, 936
FaeI	CATG	5 cut(s)	176, 529, 940, 1095, 1119
FalI	AAGNNNNNCTT	1 cut(s)	1091
FaqI	GGGAC	1 cut(s)	954
FatI	CATG	5 cut(s)	172, 525, 936, 1091, 1115
FauNDI	CATATG	1 cut(s)	139
FblI	GTMKAC	1 cut(s)	1027
Fnu4HI	GCNGC	7 cut(s)	78, 180, 390, 777, 843, 846, 911
FokI	GGATG	3 cut(s)	67, 446, 998
Fsp4HI	GCNGC	7 cut(s)	78, 180, 390, 777, 843, 846, 911
FspBI	CTAG	6 cut(s)	86, 116, 183, 335, 386, 510
GluI	GCNGC	7 cut(s)	78, 180, 390, 777, 843, 846, 911
GsuI	CTGGAG	1 cut(s)	678
HaeIII	GGCC	3 cut(s)	57, 471, 1112
HapII	CCGG	2 cut(s)	58, 198
Hin1II	CATG	5 cut(s)	176, 529, 940, 1095, 1119
HincII	GTYRAC	1 cut(s)	805
HindII	GTYRAC	1 cut(s)	805
HinfI	GANTC	5 cut(s)	61, 233, 412, 506, 1029
HpaI	GTTAAC	1 cut(s)	805
HpaII	CCGG	2 cut(s)	58, 198
HphI	GGTGA	2 cut(s)	101, 156
Hpy166II	GTNNAC	4 cut(s)	164, 293, 805, 1028
Hpy188I	TCNGA	4 cut(s)	358, 594, 688, 745
Hpy188III	TCNNGA	2 cut(s)	237, 1116
Hpy8I	GTNNAC	4 cut(s)	164, 293, 805, 1028
HpyAV	CCTTC	2 cut(s)	332, 985
HpyCH4III	ACNGT	4 cut(s)	103, 488, 628, 751
HpyCH4IV	ACGT	1 cut(s)	1004
HpyF10VI	GCNNNNNNNGC	7 cut(s)	14, 41, 395, 563, 816, 919, 928
HpyF3I	CTNAG	2 cut(s)	742, 1068
HpySE526I	ACGT	1 cut(s)	1004
Hsp92II	CATG	5 cut(s)	176, 529, 940, 1095, 1119
KspAI	GTTAAC	1 cut(s)	805
Kzo9I	GATC	3 cut(s)	46, 452, 494
LguI	GCTCTTC	2 cut(s)	276, 708
LmnI	GCTCC	1 cut(s)	797
Lsp1109I	GCAGC	5 cut(s)	89, 191, 788, 832, 897
LweI	GCATC	3 cut(s)	89, 391, 664
MaeI	CTAG	6 cut(s)	86, 116, 183, 335, 386, 510
MaeII	ACGT	1 cut(s)	1004
MaeIII	GTNAC	3 cut(s)	89, 307, 628
MalI	GATC	3 cut(s)	48, 454, 496
MbiI	CCGCTC	1 cut(s)	542
MboI	GATC	3 cut(s)	46, 452, 494
MboII	GAAGA	5 cut(s)	263, 450, 513, 563, 695
MfeI	CAATTG	1 cut(s)	992
MflI	RGATCY	1 cut(s)	452
MlsI	TGGCCA	1 cut(s)	471
MluCI	AATT	7 cut(s)	168, 498, 558, 768, 897, 923, 992
MluNI	TGGCCA	1 cut(s)	471
MlyI	GAGTC	2 cut(s)	55, 1023
MmeI	TCCRAC	1 cut(s)	244
MnlI	CCTC	5 cut(s)	75, 653, 686, 794, 946
Mox20I	TGGCCA	1 cut(s)	471
MscI	TGGCCA	1 cut(s)	471
MseI	TTAA	5 cut(s)	105, 501, 602, 804, 999
MslI	CAYNNNNRTG	1 cut(s)	198
Msp20I	TGGCCA	1 cut(s)	471
MspA1I	CMGCKG	1 cut(s)	845
MspI	CCGG	2 cut(s)	58, 198
MspR9I	CCNGG	1 cut(s)	657
MunI	CAATTG	1 cut(s)	992
Mva1269I	GAATGC	3 cut(s)	17, 271, 884
MvaI	CCWGG	1 cut(s)	657
MwoI	GCNNNNNNNGC	7 cut(s)	14, 41, 395, 563, 816, 919, 928
NcoI	CCATGG	1 cut(s)	936
NdeI	CATATG	1 cut(s)	139
NdeII	GATC	3 cut(s)	46, 452, 494
NlaIII	CATG	5 cut(s)	176, 529, 940, 1095, 1119
NmuCI	GTSAC	2 cut(s)	89, 307
NspI	RCATGY	1 cut(s)	1095
PagI	TCATGA	1 cut(s)	1115
PciI	ACATGT	1 cut(s)	1091
PciSI	GCTCTTC	2 cut(s)	276, 708
PctI	GAATGC	3 cut(s)	17, 271, 884
PfeI	GAWTC	3 cut(s)	233, 412, 506
PinAI	ACCGGT	1 cut(s)	197
PkrI	GCNGC	7 cut(s)	79, 181, 391, 778, 844, 847, 912
PleI	GAGTC	2 cut(s)	55, 1023
PpsI	GAGTC	2 cut(s)	55, 1023
PscI	ACATGT	1 cut(s)	1091
Psp1406I	AACGTT	1 cut(s)	1004
Psp6I	CCWGG	1 cut(s)	655
PspEI	GGTNACC	1 cut(s)	89
PspGI	CCWGG	1 cut(s)	655
PspPI	GGNCC	1 cut(s)	544
PstI	CTGCAG	1 cut(s)	711
PstNI	CAGNNNCTG	1 cut(s)	749
PsuI	RGATCY	1 cut(s)	452
RsaI	GTAC	2 cut(s)	422, 973
RsaNI	GTAC	2 cut(s)	421, 972
RseI	CAYNNNNRTG	1 cut(s)	198
SapI	GCTCTTC	2 cut(s)	276, 708
SaqAI	TTAA	5 cut(s)	105, 501, 602, 804, 999
SatI	GCNGC	7 cut(s)	78, 180, 390, 777, 843, 846, 911
Sau3AI	GATC	3 cut(s)	46, 452, 494
Sau96I	GGNCC	1 cut(s)	544
SchI	GAGTC	2 cut(s)	55, 1023
ScrFI	CCNGG	1 cut(s)	657
SfaNI	GCATC	3 cut(s)	89, 391, 664
SfcI	CTRYAG	2 cut(s)	707, 1024
SinI	GGWCC	1 cut(s)	544
SmiMI	CAYNNNNRTG	1 cut(s)	198
Sse9I	AATT	7 cut(s)	168, 498, 558, 768, 897, 923, 992
SsiI	CCGC	3 cut(s)	389, 542, 843
SspMI	CTAG	6 cut(s)	86, 116, 183, 335, 386, 510
StyD4I	CCNGG	1 cut(s)	655
StyI	CCWWGG	2 cut(s)	85, 936
TaaI	ACNGT	4 cut(s)	103, 488, 628, 751
TaiI	ACGT	1 cut(s)	1007
TaqI	TCGA	3 cut(s)	49, 713, 872
TaqII	GACCGA	1 cut(s)	705
TasI	AATT	7 cut(s)	168, 498, 558, 768, 897, 923, 992
TauI	GCSGC	2 cut(s)	392, 845
TfiI	GAWTC	3 cut(s)	233, 412, 506
Tru1I	TTAA	5 cut(s)	105, 501, 602, 804, 999
Tru9I	TTAA	5 cut(s)	105, 501, 602, 804, 999
TscAI	CASTG	3 cut(s)	295, 493, 754
TseFI	GTSAC	2 cut(s)	89, 307
TseI	GCWGC	5 cut(s)	77, 179, 776, 845, 910
Tsp45I	GTSAC	2 cut(s)	89, 307
TspDTI	ATGAA	3 cut(s)	161, 263, 724
TspGWI	ACGGA	1 cut(s)	1037
TspRI	CASTG	3 cut(s)	295, 493, 754
VpaK11BI	GGWCC	1 cut(s)	544
XceI	RCATGY	1 cut(s)	1095
XmaJI	CCTAGG	1 cut(s)	85
XmiI	GTMKAC	1 cut(s)	1027
XspI	CTAG	6 cut(s)	86, 116, 183, 335, 386, 510

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.