Rmu_sc0006558.1_g000006

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006558.1
Physical Location & Seq
Reverse (-)
28053 .. 28643
591 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006558.1_g000006.1.cds

Sequence Viewer

Length: 591 bp
atggatccaaggctctacaaatctgcaaaatcaggggctgtttgcttcctcagaaaacttcttagtgataatcctagccttctatataaacttacacctcgagaaaacacaaccctccatatagctgtgcaattcggacacgaaaatgtcgcggctgagatttatagcagatccaggtcacttctcaaacagcaaaacttagatggagatacacctctacatgtggctgcaaggtttggtcacttctctattgtcaactatctggttagagatgtaatttcatcagtgtcagaggtagacatggggcttgagaccctgagaattagaaatagggggaacagcacagtattacacgaagcttcaaggaatggtcactataaagtggtcgagttcttaatcaaagttgatcccaacttggcttctgttgaaaatgatgagggtgagtctccattgtatctggccgcaagaggcggaatgttagagattgtgaatcaaattataaggacaaatccgtcatcagctcatggtggttcatttggccaaacagctttgcatgctgctgtggttgaaaggcatattggtatatcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

196

Amino Acids

21.6

Weight (kDa)

7.95

Isoelectric Point (pI)

28.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 500
AasI GACNNNNNNGTC 1 cut(s) 511
AccI GTMKAC 1 cut(s) 297
AccII CGCG 1 cut(s) 152
AciI CCGC 3 cut(s) 152, 462, 471
AclWI GGATC 3 cut(s) 12, 165, 401
AcoI YGGCCR 2 cut(s) 459, 538
AflIII ACRYGT 1 cut(s) 220
AgsI TTSAA 3 cut(s) 363, 428, 569
AjnI CCWGG 1 cut(s) 173
AjuI GAANNNNNNNTTGG 1 cut(s) 561
AluBI AGCT 4 cut(s) 125, 359, 521, 548
AluI AGCT 4 cut(s) 125, 359, 521, 548
Alw26I GTCTC 2 cut(s) 305, 450
AlwI GGATC 3 cut(s) 12, 165, 401
AlwNI CAGNNNCTG 1 cut(s) 38
Ama87I CYCGRG 1 cut(s) 99
AoxI GGCC 2 cut(s) 459, 538
ApeKI GCWGC 2 cut(s) 227, 557
AsuHPI GGTGA 1 cut(s) 452
AvaI CYCGRG 1 cut(s) 99
BalI TGGCCA 1 cut(s) 540
BamHI GGATCC 1 cut(s) 4
BbvI GCAGC 2 cut(s) 214, 544
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 175
BcoDI GTCTC 2 cut(s) 305, 450
BfaI CTAG 1 cut(s) 75
BisI GCNGC 4 cut(s) 153, 228, 462, 558
BlsI GCNGC 4 cut(s) 154, 229, 463, 559
Bme1390I CCNGG 1 cut(s) 175
BmeT110I CYCGRG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 175
BpuEI CTTGAG 1 cut(s) 329
BsaI GGTCTC 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 8
BseBI CCWGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 8
BseMII CTCAG 3 cut(s) 64, 147, 308
BseXI GCAGC 2 cut(s) 214, 544
Bsh1236I CGCG 1 cut(s) 152
BshFI GGCC 2 cut(s) 461, 540
BsiHKCI CYCGRG 1 cut(s) 99
BsmAI GTCTC 2 cut(s) 305, 450
BsnI GGCC 2 cut(s) 461, 540
Bso31I GGTCTC 1 cut(s) 305
BsoBI CYCGRG 1 cut(s) 99
Bsp143I GATC 3 cut(s) 4, 170, 406
BspACI CCGC 3 cut(s) 152, 462, 471
BspANI GGCC 2 cut(s) 461, 540
BspCNI CTCAG 3 cut(s) 63, 148, 309
BspFNI CGCG 1 cut(s) 152
BspHI TCATGA 1 cut(s) 587
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 3 cut(s) 12, 165, 401
BspTNI GGTCTC 1 cut(s) 305
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 3 cut(s) 4, 170, 406
BssT1I CCWWGG 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 346
BstC8I GCNNGC 1 cut(s) 555
BstDEI CTNAG 5 cut(s) 50, 62, 156, 199, 317
BstFNI CGCG 1 cut(s) 152
BstKTI GATC 3 cut(s) 7, 173, 409
BstMAI GTCTC 2 cut(s) 305, 450
BstMBI GATC 3 cut(s) 4, 170, 406
BstMWI GCNNNNNNNGC 1 cut(s) 554
BstNI CCWGG 1 cut(s) 175
BstNSI RCATGY 2 cut(s) 224, 557
BstSCI CCNGG 1 cut(s) 173
BstUI CGCG 1 cut(s) 152
BstV1I GCAGC 2 cut(s) 214, 544
BstX2I RGATCY 2 cut(s) 4, 170
BstYI RGATCY 2 cut(s) 4, 170
BsuRI GGCC 2 cut(s) 461, 540
BtsIMutI CAGTG 1 cut(s) 291
Cac8I GCNNGC 1 cut(s) 555
CaiI CAGNNNCTG 1 cut(s) 38
CciI TCATGA 1 cut(s) 587
CviAII CATG 5 cut(s) 221, 301, 524, 554, 588
DdeI CTNAG 5 cut(s) 50, 62, 156, 199, 317
DpnI GATC 3 cut(s) 6, 172, 408
DpnII GATC 3 cut(s) 4, 170, 406
DrdI GACNNNNNNGTC 1 cut(s) 511
DseDI GACNNNNNNGTC 1 cut(s) 511
EaeI YGGCCR 2 cut(s) 459, 538
EciI GGCGGA 1 cut(s) 486
Eco130I CCWWGG 1 cut(s) 8
Eco31I GGTCTC 1 cut(s) 305
Eco88I CYCGRG 1 cut(s) 99
EcoRII CCWGG 1 cut(s) 173
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 5 cut(s) 224, 304, 527, 557, 591
FatI CATG 5 cut(s) 220, 300, 523, 553, 587
FblI GTMKAC 1 cut(s) 297
Fnu4HI GCNGC 4 cut(s) 153, 228, 462, 558
Fsp4HI GCNGC 4 cut(s) 153, 228, 462, 558
FspBI CTAG 1 cut(s) 75
GluI GCNGC 4 cut(s) 153, 228, 462, 558
HaeIII GGCC 2 cut(s) 461, 540
Hin1II CATG 5 cut(s) 224, 304, 527, 557, 591
HincII GTYRAC 1 cut(s) 256
HindII GTYRAC 1 cut(s) 256
HindIII AAGCTT 1 cut(s) 357
HinfI GANTC 2 cut(s) 443, 490
HphI GGTGA 1 cut(s) 452
Hpy166II GTNNAC 2 cut(s) 256, 298
Hpy188I TCNGA 3 cut(s) 53, 137, 292
Hpy188III TCNNGA 2 cut(s) 101, 588
Hpy8I GTNNAC 2 cut(s) 256, 298
HpyAV CCTTC 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 346
HpyCH4V TGCA 4 cut(s) 26, 130, 230, 553
HpyF10VI GCNNNNNNNGC 1 cut(s) 554
HpyF3I CTNAG 5 cut(s) 50, 62, 156, 199, 317
Hsp92II CATG 5 cut(s) 224, 304, 527, 557, 591
Kzo9I GATC 3 cut(s) 4, 170, 406
LpnPI CCDG 6 cut(s) 18, 160, 187, 248, 329, 443
Lsp1109I GCAGC 2 cut(s) 214, 544
MaeI CTAG 1 cut(s) 75
MaeIII GTNAC 3 cut(s) 177, 239, 371
MalI GATC 3 cut(s) 6, 172, 408
MboI GATC 3 cut(s) 4, 170, 406
MflI RGATCY 2 cut(s) 4, 170
MlsI TGGCCA 1 cut(s) 540
MluCI AATT 4 cut(s) 131, 276, 321, 495
MluNI TGGCCA 1 cut(s) 540
MlyI GAGTC 1 cut(s) 452
MnlI CCTC 7 cut(s) 59, 108, 125, 225, 286, 430, 461
Mox20I TGGCCA 1 cut(s) 540
MscI TGGCCA 1 cut(s) 540
MseI TTAA 1 cut(s) 395
MslI CAYNNNNRTG 1 cut(s) 144
Msp20I TGGCCA 1 cut(s) 540
MspR9I CCNGG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 175
MvnI CGCG 1 cut(s) 152
MwoI GCNNNNNNNGC 1 cut(s) 554
NdeII GATC 3 cut(s) 4, 170, 406
NlaIII CATG 5 cut(s) 224, 304, 527, 557, 591
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 3 cut(s) 177, 239, 371
NspI RCATGY 2 cut(s) 224, 557
PaeI GCATGC 1 cut(s) 557
PaeR7I CTCGAG 1 cut(s) 99
PagI TCATGA 1 cut(s) 587
PciI ACATGT 1 cut(s) 220
PfeI GAWTC 1 cut(s) 490
PkrI GCNGC 4 cut(s) 154, 229, 463, 559
PleI GAGTC 1 cut(s) 451
PpsI GAGTC 1 cut(s) 451
PscI ACATGT 1 cut(s) 220
PsiI TTATAA 1 cut(s) 500
Psp6I CCWGG 1 cut(s) 173
PspGI CCWGG 1 cut(s) 173
PspN4I GGNNCC 1 cut(s) 6
PstNI CAGNNNCTG 1 cut(s) 38
PsuI RGATCY 2 cut(s) 4, 170
RseI CAYNNNNRTG 1 cut(s) 144
SaqAI TTAA 1 cut(s) 395
SatI GCNGC 4 cut(s) 153, 228, 462, 558
Sau3AI GATC 3 cut(s) 4, 170, 406
SchI GAGTC 1 cut(s) 452
ScrFI CCNGG 1 cut(s) 175
SetI ASST 9 cut(s) 100, 127, 179, 217, 236, 297, 361, 523, 550
Sfr274I CTCGAG 1 cut(s) 99
SlaI CTCGAG 1 cut(s) 99
SmiMI CAYNNNNRTG 1 cut(s) 144
SmlI CTYRAG 2 cut(s) 99, 308
SmoI CTYRAG 2 cut(s) 99, 308
SphI GCATGC 1 cut(s) 557
Sse9I AATT 4 cut(s) 131, 276, 321, 495
SsiI CCGC 3 cut(s) 152, 462, 471
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 173
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 1 cut(s) 346
TaqI TCGA 2 cut(s) 100, 387
TasI AATT 4 cut(s) 131, 276, 321, 495
TauI GCSGC 2 cut(s) 155, 464
TfiI GAWTC 1 cut(s) 490
Tru1I TTAA 1 cut(s) 395
Tru9I TTAA 1 cut(s) 395
TscAI CASTG 1 cut(s) 291
TseFI GTSAC 3 cut(s) 177, 239, 371
TseI GCWGC 2 cut(s) 227, 557
Tsp45I GTSAC 3 cut(s) 177, 239, 371
TspDTI ATGAA 2 cut(s) 270, 522
TspGWI ACGGA 1 cut(s) 501
TspRI CASTG 1 cut(s) 291
XceI RCATGY 2 cut(s) 224, 557
XhoI CTCGAG 1 cut(s) 99
XmiI GTMKAC 1 cut(s) 297
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.