pycom11g07820

oxidoreductase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Reverse (-)
5963958 .. 5965724
1767 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g07820.1

Sequence Viewer

Length: 978 bp
ATGGGTTCCTTAACACTTCCAAAGCTTCCTACCATCAATTTCTCCATCGATGCCTTGAAGCCTGGCTCAAGTTCTTGGCTGTCCACCTCCAAACAAGTTCGATATGCACTCGAAGAGTACGGTTGTTTCGTGGCGCAGTACGATCAAGTTTCTGCACAACTTCTGAACAATATCTTTGGGCAGGCCAAAGATTTGTTTGAGGTTCCTTTGGAAAACAAAGTGAAGAACGTTAGTGATGAACCATATCGTGGGTATATTGGACCCAACCACCTCATGCCACTCTATGAAGGTATCGCCATTGATAATGTCACATCCCCACAAGAAACTCAGAAGTTCAAAAATCTCATGTGGCCCGATGGAAAGAGCAATTTCTGGCTATTTAAAAGCTATGGAGCAGAAAAGCAGTACGAGTCTGTTGCTAGTGCCAACAGCCACCTTCTTAGATTCCTCAAGTATAATAAACCAGAGGAAGCTGATCGTGCTACCTTGAGATTTGCGAGCCATACAGACAAGAACTTCACCACCATCGTCGTTCAACACGACGTTGGTGGTTTGGAGGTTAAGACCAAGGATGGTGACTGGATTAACATTGAGTCCGCACCTTCACAGTTCTTGTTCATGGCCGGTGATGGATTGCAGGTTTGTTCCCATTGCCATATAATTAAATACCATCAAGTACTTAGCTTTCAATTACAATATATACTAGTGCTACTTAGCTCAGTATGGAGCAATGATAGAATAAAAGCATGTCATCATCGAGTGAAGCATTGTGGAGATAAGACGAGGTACTCGCTTGGGTTGTTTACATTCAACAACGGAATAATACAGGTACCAGAAGAACTGGTGGACGAGAGGCACCCACTGCTCTATAACCCATTGGTTAGTCTTGAGTATATGAGGTTTCACAGTAGAGGTGAGGCCAGGAATTTAGTCTCTCCTCTCAAGACCTTTTGTGGTATTACAAATTCTACAGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

326

Amino Acids

36.92

Weight (kDa)

7.18

Isoelectric Point (pI)

33.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DIOX_N PF14226 9 - 88 1e-11 non-haem dioxygenase in morphine synthesis N-terminal
2OG-FeII_Oxy PF03171 149 - 269 1.8e-14 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 628
Acc65I GGTACC 1 cut(s) 829
AccB1I GGYRCC 2 cut(s) 829, 855
AccB7I CCANNNNNTGG 1 cut(s) 248
AciI CCGC 1 cut(s) 597
AclI AACGTT 1 cut(s) 228
AcoI YGGCCR 1 cut(s) 621
AcsI RAATTY 2 cut(s) 925, 964
AfaI GTAC 6 cut(s) 119, 140, 407, 678, 788, 831
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 5 cut(s) 58, 337, 536, 689, 811
AhlI ACTAGT 1 cut(s) 703
AjnI CCWGG 2 cut(s) 61, 920
AluBI AGCT 5 cut(s) 25, 387, 473, 684, 717
AluI AGCT 5 cut(s) 25, 387, 473, 684, 717
Alw26I GTCTC 1 cut(s) 937
AoxI GGCC 4 cut(s) 183, 350, 621, 918
ApoI RAATTY 2 cut(s) 925, 964
Asp718I GGTACC 1 cut(s) 829
AspLEI GCGC 1 cut(s) 136
AspS9I GGNCC 2 cut(s) 260, 351
AsuHPI GGTGA 4 cut(s) 511, 587, 638, 926
AvaII GGWCC 1 cut(s) 260
BanI GGYRCC 2 cut(s) 829, 855
BccI CCATC 7 cut(s) 41, 53, 350, 533, 566, 623, 678
BcgI CGANNNNNNTGC 2 cut(s) 398, 432
BciT130I CCWGG 2 cut(s) 63, 922
BcoDI GTCTC 1 cut(s) 937
BcuI ACTAGT 1 cut(s) 703
BfaI CTAG 2 cut(s) 420, 704
BfmI CTRYAG 1 cut(s) 969
BfuAI ACCTGC 1 cut(s) 628
BmcAI AGTACT 1 cut(s) 678
Bme1390I CCNGG 2 cut(s) 63, 922
Bme18I GGWCC 1 cut(s) 260
BmgT120I GGNCC 2 cut(s) 260, 351
BmiI GGNNCC 5 cut(s) 7, 204, 262, 831, 857
BmrFI CCNGG 2 cut(s) 63, 922
BmsI GCATC 1 cut(s) 40
BpuEI CTTGAG 5 cut(s) 52, 434, 508, 908, 926
Bsa29I ATCGAT 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 567
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse118I RCCGGY 1 cut(s) 623
Bse1I ACTGG 2 cut(s) 584, 846
Bse3DI GCAATG 2 cut(s) 649, 736
BseBI CCWGG 2 cut(s) 63, 922
BseCI ATCGAT 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 567
BseGI GGATG 2 cut(s) 311, 577
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 2 cut(s) 649, 736
BseMII CTCAG 2 cut(s) 341, 732
BseNI ACTGG 2 cut(s) 584, 846
BseRI GAGGAG 1 cut(s) 927
BsgI GTGCAG 1 cut(s) 138
BshFI GGCC 4 cut(s) 185, 352, 623, 920
BshNI GGYRCC 2 cut(s) 829, 855
BshVI ATCGAT 1 cut(s) 48
BsiSI CCGG 1 cut(s) 624
BslI CCNNNNNNNGG 1 cut(s) 248
BsmAI GTCTC 1 cut(s) 937
BsnI GGCC 4 cut(s) 185, 352, 623, 920
Bsp143I GATC 2 cut(s) 142, 475
BspACI CCGC 1 cut(s) 597
BspANI GGCC 4 cut(s) 185, 352, 623, 920
BspCNI CTCAG 2 cut(s) 340, 731
BspDI ATCGAT 1 cut(s) 48
BspLI GGNNCC 5 cut(s) 7, 204, 262, 831, 857
BspMI ACCTGC 1 cut(s) 628
BspT107I GGYRCC 2 cut(s) 829, 855
BsrDI GCAATG 2 cut(s) 649, 736
BsrFI RCCGGY 1 cut(s) 623
BsrI ACTGG 2 cut(s) 584, 846
BssAI RCCGGY 1 cut(s) 623
BssECI CCNNGG 1 cut(s) 567
BssMI GATC 2 cut(s) 142, 475
BssT1I CCWWGG 1 cut(s) 567
Bst2UI CCWGG 2 cut(s) 63, 922
Bst4CI ACNGT 3 cut(s) 122, 609, 908
Bst6I CTCTTC 1 cut(s) 108
BstAPI GCANNNNNTGC 1 cut(s) 862
BstC8I GCNNGC 2 cut(s) 183, 499
BstDEI CTNAG 5 cut(s) 327, 440, 680, 713, 718
BstF5I GGATG 2 cut(s) 311, 577
BstHHI GCGC 1 cut(s) 136
BstKTI GATC 2 cut(s) 145, 478
BstMAI GTCTC 1 cut(s) 937
BstMBI GATC 2 cut(s) 142, 475
BstMWI GCNNNNNNNGC 2 cut(s) 479, 862
BstNI CCWGG 2 cut(s) 63, 922
BstNSI RCATGY 1 cut(s) 750
BstSCI CCNGG 2 cut(s) 61, 920
BstSFI CTRYAG 1 cut(s) 969
Bsu15I ATCGAT 1 cut(s) 48
BsuRI GGCC 4 cut(s) 185, 352, 623, 920
BsuTUI ATCGAT 1 cut(s) 48
BtsCI GGATG 2 cut(s) 311, 577
BtsI GCAGTG 1 cut(s) 860
BtsIMutI CAGTG 1 cut(s) 860
BveI ACCTGC 1 cut(s) 628
Cac8I GCNNGC 2 cut(s) 183, 499
CfoI GCGC 1 cut(s) 136
Cfr10I RCCGGY 1 cut(s) 623
Cfr13I GGNCC 2 cut(s) 260, 351
ClaI ATCGAT 1 cut(s) 48
Csp6I GTAC 6 cut(s) 118, 139, 406, 677, 787, 830
CviAII CATG 4 cut(s) 274, 346, 619, 747
CviQI GTAC 6 cut(s) 118, 139, 406, 677, 787, 830
DdeI CTNAG 5 cut(s) 327, 440, 680, 713, 718
DpnI GATC 2 cut(s) 144, 477
DpnII GATC 2 cut(s) 142, 475
DraI TTTAAA 1 cut(s) 382
EaeI YGGCCR 1 cut(s) 621
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco130I CCWWGG 1 cut(s) 567
Eco47I GGWCC 1 cut(s) 260
EcoRII CCWGG 2 cut(s) 61, 920
EcoT14I CCWWGG 1 cut(s) 567
ErhI CCWWGG 1 cut(s) 567
FaeI CATG 4 cut(s) 277, 349, 622, 750
FatI CATG 4 cut(s) 273, 345, 618, 746
FokI GGATG 2 cut(s) 298, 584
FspBI CTAG 2 cut(s) 420, 704
GlaI GCGC 1 cut(s) 135
HaeIII GGCC 4 cut(s) 185, 352, 623, 920
HapII CCGG 1 cut(s) 624
HhaI GCGC 1 cut(s) 136
Hin1II CATG 4 cut(s) 277, 349, 622, 750
Hin6I GCGC 1 cut(s) 134
HinP1I GCGC 1 cut(s) 134
HindIII AAGCTT 1 cut(s) 23
HinfI GANTC 3 cut(s) 410, 444, 593
HpaII CCGG 1 cut(s) 624
HphI GGTGA 4 cut(s) 511, 587, 638, 926
Hpy166II GTNNAC 3 cut(s) 84, 804, 847
Hpy188I TCNGA 2 cut(s) 165, 330
Hpy188III TCNNGA 2 cut(s) 887, 943
Hpy8I GTNNAC 3 cut(s) 84, 804, 847
Hpy99I CGWCG 2 cut(s) 533, 545
HpyAV CCTTC 3 cut(s) 281, 446, 612
HpyCH4III ACNGT 3 cut(s) 122, 609, 908
HpyCH4IV ACGT 2 cut(s) 228, 543
HpyCH4V TGCA 3 cut(s) 107, 155, 637
HpyF10VI GCNNNNNNNGC 2 cut(s) 479, 862
HpyF3I CTNAG 5 cut(s) 327, 440, 680, 713, 718
HpySE526I ACGT 2 cut(s) 228, 543
Hsp92II CATG 4 cut(s) 277, 349, 622, 750
HspAI GCGC 1 cut(s) 134
KpnI GGTACC 1 cut(s) 833
Kzo9I GATC 2 cut(s) 142, 475
LmnI GCTCC 2 cut(s) 392, 726
LweI GCATC 1 cut(s) 40
MaeI CTAG 2 cut(s) 420, 704
MaeII ACGT 2 cut(s) 228, 543
MaeIII GTNAC 2 cut(s) 307, 575
MalI GATC 2 cut(s) 144, 477
MboI GATC 2 cut(s) 142, 475
MboII GAAGA 3 cut(s) 125, 235, 848
MluCI AATT 6 cut(s) 37, 367, 660, 689, 925, 964
MlyI GAGTC 2 cut(s) 419, 602
MseI TTAA 5 cut(s) 11, 381, 561, 585, 663
MspI CCGG 1 cut(s) 624
MspR9I CCNGG 2 cut(s) 63, 922
MvaI CCWGG 2 cut(s) 63, 922
MwoI GCNNNNNNNGC 2 cut(s) 479, 862
NdeII GATC 2 cut(s) 142, 475
NlaIII CATG 4 cut(s) 277, 349, 622, 750
NlaIV GGNNCC 5 cut(s) 7, 204, 262, 831, 857
NmuCI GTSAC 2 cut(s) 307, 575
NspI RCATGY 1 cut(s) 750
PcsI WCGNNNNNNNCGW 2 cut(s) 126, 537
PfeI GAWTC 1 cut(s) 444
PflMI CCANNNNNTGG 1 cut(s) 248
PleI GAGTC 2 cut(s) 418, 601
PpsI GAGTC 2 cut(s) 418, 601
Psp1406I AACGTT 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 61, 920
PspGI CCWGG 2 cut(s) 61, 920
PspN4I GGNNCC 5 cut(s) 7, 204, 262, 831, 857
PspPI GGNCC 2 cut(s) 260, 351
RsaI GTAC 6 cut(s) 119, 140, 407, 678, 788, 831
RsaNI GTAC 6 cut(s) 118, 139, 406, 677, 787, 830
SaqAI TTAA 5 cut(s) 11, 381, 561, 585, 663
Sau3AI GATC 2 cut(s) 142, 475
Sau96I GGNCC 2 cut(s) 260, 351
ScaI AGTACT 1 cut(s) 678
SchI GAGTC 2 cut(s) 419, 602
ScrFI CCNGG 2 cut(s) 63, 922
SfaNI GCATC 1 cut(s) 40
SfcI CTRYAG 1 cut(s) 969
SinI GGWCC 1 cut(s) 260
SmlI CTYRAG 5 cut(s) 67, 449, 487, 887, 941
SmoI CTYRAG 5 cut(s) 67, 449, 487, 887, 941
SpeI ACTAGT 1 cut(s) 703
Sse9I AATT 6 cut(s) 37, 367, 660, 689, 925, 964
SsiI CCGC 1 cut(s) 597
SspMI CTAG 2 cut(s) 420, 704
StyD4I CCNGG 2 cut(s) 61, 920
StyI CCWWGG 1 cut(s) 567
TaaI ACNGT 3 cut(s) 122, 609, 908
TaiI ACGT 2 cut(s) 231, 546
TaqI TCGA 4 cut(s) 48, 100, 111, 757
TasI AATT 6 cut(s) 37, 367, 660, 689, 925, 964
TatI WGTACW 1 cut(s) 676
TfiI GAWTC 1 cut(s) 444
Tru1I TTAA 5 cut(s) 11, 381, 561, 585, 663
Tru9I TTAA 5 cut(s) 11, 381, 561, 585, 663
TscAI CASTG 1 cut(s) 867
TseFI GTSAC 2 cut(s) 307, 575
Tsp45I GTSAC 2 cut(s) 307, 575
TspDTI ATGAA 3 cut(s) 252, 300, 607
TspGWI ACGGA 1 cut(s) 831
TspRI CASTG 1 cut(s) 867
Van91I CCANNNNNTGG 1 cut(s) 248
VpaK11BI GGWCC 1 cut(s) 260
XapI RAATTY 2 cut(s) 925, 964
XceI RCATGY 1 cut(s) 750
XspI CTAG 2 cut(s) 420, 704
ZrmI AGTACT 1 cut(s) 678
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.