Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001103.1

Orthogroup ID

OG0001604

Physical Location & Seq

Genomic Coordinates Forward (+)

119090 .. 120583

Gene Structure 1494 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001103.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 942 bp

atgacacttcccaaagagcttcccaacatcaatttctccctccaagacttgaagcctggctcaagctcctgggcttcgacctgcaaacaagtccgctatgcactcgaagaatacggttgctttgtggctttgtaccaacaagtttccccacagctcatggacaatatctttggccaatccagggatttgttcgatgttccccttgaaaacaaagtcaagaacaccagcgaggagccttaccgtggctatatcggaccaaacccgctcatgccgctctatgaaggcatggccattgacaacgtcacatccccacaagaaactcaaaagttcagggacctcatgtggcctaatggaaagaccaaattctgtgaaatcacagatctgtttgccaagttgctcggggacttggaaaacacagtggaaaaaatgatgttcgaaagctttggggtaccccaagagcaatatgaatcgttggcgagttcaaacagtcatcttcttcgttttctcaagtacaggacaccagaagagagcgacacagtcataaggtttccgagccacacagacaagaacttcactaccattgttgttcagcatgatgtcggtggccttgaggttcagactaaggatggtgattggattagtgtcgagtctgcaccttctcagttcctcttcatggctggtgatggacttcaggtatggagcaatgacagagtgaaagcttgccaccatcgagtgaagcactgcggggacaagactcgatactcactgggaatgtttacgtttaacaatggagtattccaagtacccaaagagctagtagacgacagccacccactcctctacaaccagttcgacagtcgtggcttcataagattttacaccacagaggaggccaagaaggcaaagtcacccatcaaagcctattgcggtgttaaaaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

313

Amino Acids

35.76

Weight (kDa)

5.71

Isoelectric Point (pI)

42.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001604)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28210 FvH4_6g42700 FvH4_7g15780
malus_domestica	MD03G1085000.v1.1 MD05G1208700.v1.1 MD10G1195200.v1.1 MD11G1092600.v1.1
prunus_persica	Prupe.4G262900_v2.0.a1 Prupe.4G263000_v2.0.a1 Prupe.4G263100_v2.0.a1 Prupe.4G264400_v2.0.a1
pyrus_communis	pycom03g06720 pycom05g19460 pycom10g16890 pycom11g07800 pycom11g07820
rosa_chinensis	RchiOBHm_Chr1g0358581 RchiOBHm_Chr4g0395841 RchiOBHm_Chr4g0444921 RchiOBHm_Chr5g0050321 RchiOBHm_Chr5g0050341
rosa_laevigata	RLG00000027944 RLG00000034696 RLG00000034697 RLG00000034698
rosa_multiflora	Rmu_sc0001103.1_g000025 Rmu_sc0001609.1_g000014 Rmu_sc0005060.1_g000004 Rmu_sc0005060.1_g000006
rosa_roxburghii	Rroxscaffold_1G00027250 Rroxscaffold_1G00030670 Rroxscaffold_1G00030700 Rroxscaffold_4G00297680 Rroxscaffold_4G00297780
rosa_rugosa	Rorug01G0262600 Rorug01G0262700 Rorug05G0260000 Rorug05G0260000 Rorug05G0260100
rosa_samantha	Rh1BG243900 Rh1CG260900 Rh4BG429600 Rh4DG425500 Rh5AG331700 Rh5AG331800 Rh5CG369400 Rh5CG369500
rosa_wichuraiana	Rw1G024650 Rw5G031370 Rw5G031380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	89
Acc65I	GGTACC	1 cut(s)	448
AccB1I	GGYRCC	1 cut(s)	448
AccBSI	CCGCTC	2 cut(s)	265, 274
AccI	GTMKAC	1 cut(s)	819
AciI	CCGC	5 cut(s)	94, 263, 272, 744, 927
AcoI	YGGCCR	2 cut(s)	172, 288
AcsI	RAATTY	1 cut(s)	362
AcuI	CTGAAG	1 cut(s)	674
AfaI	GTAC	4 cut(s)	134, 450, 512, 804
AfiI	CCNNNNNNNGG	3 cut(s)	181, 242, 673
AgsI	TTSAA	3 cut(s)	52, 206, 483
AjnI	CCWGG	3 cut(s)	55, 68, 179
AjuI	GAANNNNNNNTTGG	2 cut(s)	17, 49
AluBI	AGCT	6 cut(s)	19, 66, 154, 441, 719, 814
AluI	AGCT	6 cut(s)	19, 66, 154, 441, 719, 814
Ama87I	CYCGRG	1 cut(s)	398
AoxI	GGCC	5 cut(s)	172, 288, 344, 604, 891
ApoI	RAATTY	1 cut(s)	362
ArsI	GACNNNNNNTTYG	2 cut(s)	152, 184
Asp718I	GGTACC	1 cut(s)	448
AspS9I	GGNCC	2 cut(s)	254, 334
AsuHPI	GGTGA	3 cut(s)	641, 692, 900
AsuII	TTCGAA	1 cut(s)	435
AvaI	CYCGRG	1 cut(s)	398
AvaII	GGWCC	2 cut(s)	254, 334
BalI	TGGCCA	2 cut(s)	174, 290
BanI	GGYRCC	1 cut(s)	448
BccI	CCATC	4 cut(s)	620, 677, 735, 920
BciT130I	CCWGG	3 cut(s)	57, 70, 181
BfaI	CTAG	1 cut(s)	815
BfuAI	ACCTGC	1 cut(s)	89
BglI	GCCNNNNNGGC	1 cut(s)	899
BglII	AGATCT	1 cut(s)	379
BisI	GCNGC	1 cut(s)	272
BlsI	GCNGC	1 cut(s)	273
Bme1390I	CCNGG	3 cut(s)	57, 70, 181
Bme18I	GGWCC	2 cut(s)	254, 334
BmeT110I	CYCGRG	1 cut(s)	398
BmgT120I	GGNCC	2 cut(s)	254, 334
BmiI	GGNNCC	3 cut(s)	234, 335, 450
BmrFI	CCNGG	3 cut(s)	57, 70, 181
BmrI	ACTGGG	1 cut(s)	776
BmuI	ACTGGG	1 cut(s)	776
Bpu14I	TTCGAA	1 cut(s)	435
BpuEI	CTTGAG	3 cut(s)	46, 491, 629
BsaJI	CCNNGG	3 cut(s)	69, 180, 241
Bsc4I	CCNNNNNNNGG	3 cut(s)	181, 242, 673
Bse1I	ACTGG	2 cut(s)	771, 847
Bse3DI	GCAATG	1 cut(s)	709
BseBI	CCWGG	3 cut(s)	57, 70, 181
BseDI	CCNNGG	3 cut(s)	69, 180, 241
BseGI	GGATG	2 cut(s)	305, 631
BseLI	CCNNNNNNNGG	3 cut(s)	181, 242, 673
BseMI	GCAATG	1 cut(s)	709
BseMII	CTCAG	1 cut(s)	674
BseNI	ACTGG	2 cut(s)	771, 847
BseRI	GAGGAG	3 cut(s)	245, 827, 902
BsgI	GTGCAG	1 cut(s)	636
BshFI	GGCC	5 cut(s)	174, 290, 346, 606, 893
BshNI	GGYRCC	1 cut(s)	448
BsiHKCI	CYCGRG	1 cut(s)	398
BslFI	GGGAC	3 cut(s)	347, 416, 761
BslI	CCNNNNNNNGG	3 cut(s)	181, 242, 673
BsmFI	GGGAC	3 cut(s)	347, 416, 761
BsnI	GGCC	5 cut(s)	174, 290, 346, 606, 893
BsoBI	CYCGRG	1 cut(s)	398
Bsp119I	TTCGAA	1 cut(s)	435
Bsp143I	GATC	1 cut(s)	379
BspACI	CCGC	5 cut(s)	94, 263, 272, 744, 927
BspANI	GGCC	5 cut(s)	174, 290, 346, 606, 893
BspCNI	CTCAG	1 cut(s)	673
BspLI	GGNNCC	3 cut(s)	234, 335, 450
BspMI	ACCTGC	1 cut(s)	89
BspT104I	TTCGAA	1 cut(s)	435
BspT107I	GGYRCC	1 cut(s)	448
BsrBI	CCGCTC	2 cut(s)	265, 274
BsrDI	GCAATG	1 cut(s)	709
BsrI	ACTGG	2 cut(s)	771, 847
BssECI	CCNNGG	3 cut(s)	69, 180, 241
BssMI	GATC	1 cut(s)	379
Bst2UI	CCWGG	3 cut(s)	57, 70, 181
Bst4CI	ACNGT	6 cut(s)	116, 242, 418, 488, 538, 857
Bst6I	CTCTTC	2 cut(s)	519, 674
BstBI	TTCGAA	1 cut(s)	435
BstC8I	GCNNGC	1 cut(s)	721
BstDEI	CTNAG	2 cut(s)	621, 660
BstDSI	CCRYGG	1 cut(s)	241
BstF5I	GGATG	2 cut(s)	305, 631
BstKTI	GATC	1 cut(s)	382
BstMBI	GATC	1 cut(s)	379
BstMWI	GCNNNNNNNGC	2 cut(s)	271, 899
BstNI	CCWGG	3 cut(s)	57, 70, 181
BstSCI	CCNGG	3 cut(s)	55, 68, 179
BstX2I	RGATCY	1 cut(s)	379
BstYI	RGATCY	1 cut(s)	379
BsuRI	GGCC	5 cut(s)	174, 290, 346, 606, 893
BtgI	CCRYGG	1 cut(s)	241
BtsCI	GGATG	2 cut(s)	305, 631
BtsI	GCAGTG	1 cut(s)	739
BtsIMutI	CAGTG	3 cut(s)	423, 739, 764
BveI	ACCTGC	1 cut(s)	89
Cac8I	GCNNGC	1 cut(s)	721
Cfr13I	GGNCC	2 cut(s)	254, 334
Csp6I	GTAC	4 cut(s)	133, 449, 511, 803
CviAII	CATG	6 cut(s)	157, 268, 286, 340, 593, 673
CviQI	GTAC	4 cut(s)	133, 449, 511, 803
DdeI	CTNAG	2 cut(s)	621, 660
DpnI	GATC	1 cut(s)	381
DpnII	GATC	1 cut(s)	379
EaeI	YGGCCR	2 cut(s)	172, 288
Eam1104I	CTCTTC	2 cut(s)	519, 674
EarI	CTCTTC	2 cut(s)	519, 674
Eco47I	GGWCC	2 cut(s)	254, 334
Eco57I	CTGAAG	1 cut(s)	674
Eco88I	CYCGRG	1 cut(s)	398
EcoO109I	RGGNCCY	1 cut(s)	334
EcoRII	CCWGG	3 cut(s)	55, 68, 179
FaeI	CATG	6 cut(s)	160, 271, 289, 343, 596, 676
FaqI	GGGAC	3 cut(s)	347, 416, 761
FatI	CATG	6 cut(s)	156, 267, 285, 339, 592, 672
FauI	CCCGC	2 cut(s)	270, 737
FblI	GTMKAC	1 cut(s)	819
Fnu4HI	GCNGC	1 cut(s)	272
FokI	GGATG	2 cut(s)	292, 638
Fsp4HI	GCNGC	1 cut(s)	272
FspBI	CTAG	1 cut(s)	815
GluI	GCNGC	1 cut(s)	272
HaeIII	GGCC	5 cut(s)	174, 290, 346, 606, 893
Hin1II	CATG	6 cut(s)	160, 271, 289, 343, 596, 676
HindIII	AAGCTT	2 cut(s)	439, 717
HinfI	GANTC	3 cut(s)	467, 647, 754
HphI	GGTGA	3 cut(s)	641, 692, 900
Hpy166II	GTNNAC	2 cut(s)	777, 820
Hpy188I	TCNGA	3 cut(s)	254, 552, 618
Hpy188III	TCNNGA	1 cut(s)	217
Hpy8I	GTNNAC	2 cut(s)	777, 820
HpyAV	CCTTC	3 cut(s)	275, 666, 892
HpyCH4III	ACNGT	6 cut(s)	116, 242, 418, 488, 538, 857
HpyCH4IV	ACGT	2 cut(s)	300, 779
HpyCH4V	TGCA	3 cut(s)	84, 101, 653
HpyF10VI	GCNNNNNNNGC	2 cut(s)	271, 899
HpyF3I	CTNAG	2 cut(s)	621, 660
HpySE526I	ACGT	2 cut(s)	300, 779
Hsp92II	CATG	6 cut(s)	160, 271, 289, 343, 596, 676
KpnI	GGTACC	1 cut(s)	452
Kzo9I	GATC	1 cut(s)	379
LmnI	GCTCC	3 cut(s)	71, 232, 699
MaeI	CTAG	1 cut(s)	815
MaeII	ACGT	2 cut(s)	300, 779
MaeIII	GTNAC	2 cut(s)	301, 906
MalI	GATC	1 cut(s)	381
MbiI	CCGCTC	2 cut(s)	265, 274
MboI	GATC	1 cut(s)	379
MboII	GAAGA	5 cut(s)	119, 485, 488, 536, 661
MflI	RGATCY	1 cut(s)	379
MlsI	TGGCCA	2 cut(s)	174, 290
MluCI	AATT	2 cut(s)	31, 362
MluNI	TGGCCA	2 cut(s)	174, 290
MlyI	GAGTC	2 cut(s)	656, 748
MnlI	CCTC	8 cut(s)	50, 223, 347, 604, 677, 848, 880, 883
Mox20I	TGGCCA	2 cut(s)	174, 290
MscI	TGGCCA	2 cut(s)	174, 290
MseI	TTAA	2 cut(s)	783, 933
Msp20I	TGGCCA	2 cut(s)	174, 290
MspR9I	CCNGG	3 cut(s)	57, 70, 181
MvaI	CCWGG	3 cut(s)	57, 70, 181
MwoI	GCNNNNNNNGC	2 cut(s)	271, 899
NdeII	GATC	1 cut(s)	379
NlaIII	CATG	6 cut(s)	160, 271, 289, 343, 596, 676
NlaIV	GGNNCC	3 cut(s)	234, 335, 450
NmuCI	GTSAC	2 cut(s)	301, 906
NspV	TTCGAA	1 cut(s)	435
PfeI	GAWTC	1 cut(s)	467
PflFI	GACNNNGTC	2 cut(s)	299, 536
PkrI	GCNGC	1 cut(s)	273
PleI	GAGTC	2 cut(s)	655, 748
PpsI	GAGTC	2 cut(s)	655, 748
PpuMI	RGGWCCY	1 cut(s)	334
Psp5II	RGGWCCY	1 cut(s)	334
Psp6I	CCWGG	3 cut(s)	55, 68, 179
PspGI	CCWGG	3 cut(s)	55, 68, 179
PspN4I	GGNNCC	3 cut(s)	234, 335, 450
PspPI	GGNCC	2 cut(s)	254, 334
PspPPI	RGGWCCY	1 cut(s)	334
PsuI	RGATCY	1 cut(s)	379
PsyI	GACNNNGTC	2 cut(s)	299, 536
RsaI	GTAC	4 cut(s)	134, 450, 512, 804
RsaNI	GTAC	4 cut(s)	133, 449, 511, 803
SaqAI	TTAA	2 cut(s)	783, 933
SatI	GCNGC	1 cut(s)	272
Sau3AI	GATC	1 cut(s)	379
Sau96I	GGNCC	2 cut(s)	254, 334
SchI	GAGTC	2 cut(s)	656, 748
ScrFI	CCNGG	3 cut(s)	57, 70, 181
SfuI	TTCGAA	1 cut(s)	435
SinI	GGWCC	2 cut(s)	254, 334
SmlI	CTYRAG	3 cut(s)	61, 506, 608
SmoI	CTYRAG	3 cut(s)	61, 506, 608
Sse9I	AATT	2 cut(s)	31, 362
SsiI	CCGC	5 cut(s)	94, 263, 272, 744, 927
SspMI	CTAG	1 cut(s)	815
StyD4I	CCNGG	3 cut(s)	55, 68, 179
TaaI	ACNGT	6 cut(s)	116, 242, 418, 488, 538, 857
TaiI	ACGT	2 cut(s)	303, 782
TaqI	TCGA	8 cut(s)	77, 105, 192, 435, 645, 730, 757, 852
TasI	AATT	2 cut(s)	31, 362
TatI	WGTACW	1 cut(s)	510
TauI	GCSGC	1 cut(s)	274
TfiI	GAWTC	1 cut(s)	467
Tru1I	TTAA	2 cut(s)	783, 933
Tru9I	TTAA	2 cut(s)	783, 933
TscAI	CASTG	3 cut(s)	423, 746, 771
TseFI	GTSAC	2 cut(s)	301, 906
Tsp45I	GTSAC	2 cut(s)	301, 906
TspDTI	ATGAA	4 cut(s)	294, 480, 661, 856
TspRI	CASTG	3 cut(s)	423, 746, 771
Tth111I	GACNNNGTC	2 cut(s)	299, 536
VpaK11BI	GGWCC	2 cut(s)	254, 334
XapI	RAATTY	1 cut(s)	362
XmiI	GTMKAC	1 cut(s)	819
XspI	CTAG	1 cut(s)	815

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.