pycom13g06790

Protein of unknown function (DUF1664)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
4497899 .. 4498944
1046 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g06790.3

Sequence Viewer

Length: 210 bp
ATGCCTAAAACTCTGCAGAAGCAACTTGAAAACTCTGGGAAGTCACGTGGTCGTTTACCATCATATTCAGATGCTTCGGGCCTGATGGGTCTTAAAGAAATTGCGGACTCTCTGTCTGAAACTTTAAATCCATCAACTGATGCTATTGTGAAAGATGATACTGAAATGACAGGAGAGAATCAGAAGAATAACCTGATAAGGTTTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.6

Weight (kDa)

5.05

Isoelectric Point (pI)

33.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 104
AcvI CACGTG 1 cut(s) 47
AgsI TTSAA 2 cut(s) 29, 206
AhdI GACNNNNNGTC 1 cut(s) 112
AoxI GGCC 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 79
BbrPI CACGTG 1 cut(s) 47
BccI CCATC 3 cut(s) 67, 79, 139
BfmI CTRYAG 1 cut(s) 14
BmeRI GACNNNNNGTC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 79
BmsI GCATC 2 cut(s) 61, 130
BsaAI YACGTR 1 cut(s) 47
BshFI GGCC 1 cut(s) 81
BsnI GGCC 1 cut(s) 81
BspACI CCGC 1 cut(s) 104
BspANI GGCC 1 cut(s) 81
BspMAI CTGCAG 1 cut(s) 18
BstBAI YACGTR 1 cut(s) 47
BstSFI CTRYAG 1 cut(s) 14
BsuRI GGCC 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 79
CviJI RGCY 1 cut(s) 81
CviKI_1 RGCY 1 cut(s) 81
DraI TTTAAA 1 cut(s) 126
DriI GACNNNNNGTC 1 cut(s) 112
Eam1105I GACNNNNNGTC 1 cut(s) 112
Eco72I CACGTG 1 cut(s) 47
FaiI YATR 1 cut(s) 64
HaeIII GGCC 1 cut(s) 81
HinfI GANTC 2 cut(s) 107, 178
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 3 cut(s) 70, 118, 183
Hpy8I GTNNAC 1 cut(s) 56
HpyCH4IV ACGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 16
HpySE526I ACGT 1 cut(s) 46
LpnPI CCDG 4 cut(s) 21, 95, 156, 206
LweI GCATC 2 cut(s) 61, 130
MaeII ACGT 1 cut(s) 46
MaeIII GTNAC 1 cut(s) 42
MboII GAAGA 1 cut(s) 196
MluCI AATT 1 cut(s) 99
MlyI GAGTC 1 cut(s) 101
MseI TTAA 2 cut(s) 93, 125
NmuCI GTSAC 1 cut(s) 42
PfeI GAWTC 1 cut(s) 178
PleI GAGTC 1 cut(s) 101
PmaCI CACGTG 1 cut(s) 47
PmlI CACGTG 1 cut(s) 47
PpsI GAGTC 1 cut(s) 101
Ppu21I YACGTR 1 cut(s) 47
PspCI CACGTG 1 cut(s) 47
PspPI GGNCC 1 cut(s) 79
PstI CTGCAG 1 cut(s) 18
SaqAI TTAA 2 cut(s) 93, 125
Sau96I GGNCC 1 cut(s) 79
SchI GAGTC 1 cut(s) 101
SetI ASST 3 cut(s) 49, 195, 203
SfaNI GCATC 2 cut(s) 61, 130
SfcI CTRYAG 1 cut(s) 14
SgeI CNNG 8 cut(s) 38, 48, 57, 59, 90, 94, 183, 205
Sse9I AATT 1 cut(s) 99
SsiI CCGC 1 cut(s) 104
TaiI ACGT 1 cut(s) 49
TasI AATT 1 cut(s) 99
TfiI GAWTC 1 cut(s) 178
Tru1I TTAA 2 cut(s) 93, 125
Tru9I TTAA 2 cut(s) 93, 125
TseFI GTSAC 1 cut(s) 42
Tsp45I GTSAC 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.