Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0016635.1

Orthogroup ID

OG0003884

Physical Location & Seq

Genomic Coordinates Forward (+)

593 .. 4362

Gene Structure 3770 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0016635.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 891 bp

atggctatgcaaattggtcttagcagggtccttctcatagctggagcaggttacactagctccatcctcgttaggaacggcaaactctccgacgtgatcgctgagcttcaggctttgttgaatggatcaggagagcaatcagaaggtgattctgataagattgcatcgcagatgtataaccgattgctggatgagatacgctctgcacgacaaacagttgtgctgaatgctaatgggggtggccaaggtaacttgacatcacttatagtgccagctgctaccttgggggcagtgggttacggttacatgtggtggaagggtcttaaattctcggatctcatgtatgtgacaaagcgtaatatgactgctgctgttacaaacttgacaaaaagtctggatactgtaaaagaagctgttgtcaacacgaagaagcacctgacacagagaatccagaatttggatgataaagtgctggaacaaaatgatctctcaaagtcaattaagaatgatgttgctggagttcaacattctctcactgatctggactttaacttgagtcaactgcagagcttggtctctggtctggattggaagatatgttctcttgaagaaaagcaggatttcgcaaatatgggtgttgcttacctttgcagctttgttggtgggaaaaaagttgaaatgcctggagctttgcagaagcaacttaaaaattctgataatgcacggggtggccgattactctcatattcagaaccaagcataatggggcttaaagaaattgcggatactgtgtccgcccgtttgaatagtgatggtatcgtgcaagatgatattcccaagttggaagagcctccaaggaacctgctgaggtcggtgtcaaccaagtgttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1664

Protein Analysis

296

Amino Acids

32.14

Weight (kDa)

7.64

Isoelectric Point (pI)

31.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003884)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G27000 AT2G02730 AT2G02730 AT2G02730
fragaria_vesca	FvH4_1g20311 FvH4_1g20311 FvH4_1g20311 FvH4_1g20311 FvH4_4g31870
malus_domestica	MD05G1007200.v1.1 MD13G1078200.v1.1 MD16G1077900.v1.1
prunus_persica	Prupe.1G268900_v2.0.a1
pyrus_communis	pycom13g06780 pycom13g06790 pycom16g06730
rosa_chinensis	RchiOBHm_Chr4g0440531
rosa_laevigata	RLG00000006171
rosa_multiflora	Rmu_sc0016635.1_g000001 Rmu_sc0037701.1_g000002
rosa_roxburghii	Rroxscaffold_5G00381360
rosa_rugosa	Rorug04G0326500 Rorug04G0326600
rosa_samantha	Rh1AG290600 Rh2AG297000 Rh4AG378200 Rh4BG390800 Rh4CG405500 Rh4DG384500
rosa_wichuraiana	Rw0G013060 Rw2G026030 Rw4G032370 Rw4G032470 Rw7G024050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	38, 870
AccB7I	CCANNNNNTGG	1 cut(s)	457
AciI	CCGC	2 cut(s)	782, 795
AclWI	GGATC	2 cut(s)	133, 342
AcoI	YGGCCR	2 cut(s)	241, 730
AcsI	RAATTY	3 cut(s)	326, 454, 709
AcuI	CTGAAG	1 cut(s)	92
AdeI	CACNNNGTG	1 cut(s)	728
AfiI	CCNNNNNNNGG	2 cut(s)	187, 457
AflIII	ACRYGT	1 cut(s)	306
AgsI	TTSAA	5 cut(s)	121, 524, 608, 677, 805
AhdI	GACNNNNNGTC	1 cut(s)	390
AjiI	CACGTC	1 cut(s)	94
AjnI	CCWGG	1 cut(s)	682
AloI	GAACNNNNNNTCC	2 cut(s)	583, 615
AluBI	AGCT	8 cut(s)	41, 60, 106, 275, 413, 570, 654, 689
AluI	AGCT	8 cut(s)	41, 60, 106, 275, 413, 570, 654, 689
Alw26I	GTCTC	1 cut(s)	580
AlwI	GGATC	2 cut(s)	133, 342
AoxI	GGCC	2 cut(s)	241, 730
ApeKI	GCWGC	3 cut(s)	275, 368, 651
ApoI	RAATTY	3 cut(s)	326, 454, 709
AspS9I	GGNCC	1 cut(s)	28
AsuHPI	GGTGA	1 cut(s)	158
AvaII	GGWCC	1 cut(s)	28
BalI	TGGCCA	1 cut(s)	243
BbvCI	CCTCAGC	1 cut(s)	866
BbvI	GCAGC	3 cut(s)	262, 355, 663
BccI	CCATC	2 cut(s)	71, 806
BceAI	ACGGC	1 cut(s)	94
BciT130I	CCWGG	1 cut(s)	684
BciVI	GTATCC	2 cut(s)	391, 778
BcoDI	GTCTC	1 cut(s)	580
BfaI	CTAG	1 cut(s)	57
BfmI	CTRYAG	1 cut(s)	563
BfuAI	ACCTGC	2 cut(s)	38, 870
BfuI	GTATCC	2 cut(s)	391, 778
BisI	GCNGC	3 cut(s)	276, 369, 652
BlpI	GCTNAGC	1 cut(s)	102
BlsI	GCNGC	3 cut(s)	277, 370, 653
Bme1390I	CCNGG	1 cut(s)	684
Bme18I	GGWCC	1 cut(s)	28
BmeRI	GACNNNNNGTC	1 cut(s)	390
BmgBI	CACGTC	1 cut(s)	94
BmgT120I	GGNCC	1 cut(s)	28
BmiI	GGNNCC	2 cut(s)	29, 860
BmrFI	CCNGG	1 cut(s)	684
BmsI	GCATC	1 cut(s)	173
BplI	GAGNNNNNCTC	2 cut(s)	185, 217
BpmI	CTGGAG	3 cut(s)	63, 537, 705
Bpu10I	CCTNAGC	1 cut(s)	866
Bpu1102I	GCTNAGC	1 cut(s)	102
BpuEI	CTTGAG	1 cut(s)	574
BsaI	GGTCTC	1 cut(s)	580
BsaJI	CCNNGG	3 cut(s)	244, 282, 854
BsaXI	ACNNNNNCTCC	2 cut(s)	44, 74
Bsc4I	CCNNNNNNNGG	2 cut(s)	187, 457
BseBI	CCWGG	1 cut(s)	684
BseDI	CCNNGG	3 cut(s)	244, 282, 854
BseGI	GGATG	3 cut(s)	63, 196, 466
BseLI	CCNNNNNNNGG	2 cut(s)	187, 457
BseMII	CTCAG	2 cut(s)	93, 857
BseXI	GCAGC	3 cut(s)	262, 355, 663
BsgI	GTGCAG	1 cut(s)	189
BshFI	GGCC	2 cut(s)	243, 732
BslI	CCNNNNNNNGG	2 cut(s)	187, 457
BsmAI	GTCTC	1 cut(s)	580
BsmI	GAATGC	1 cut(s)	232
BsnI	GGCC	2 cut(s)	243, 732
Bso31I	GGTCTC	1 cut(s)	580
Bsp143I	GATC	5 cut(s)	96, 125, 334, 484, 538
Bsp1720I	GCTNAGC	1 cut(s)	102
BspACI	CCGC	2 cut(s)	782, 795
BspANI	GGCC	2 cut(s)	243, 732
BspCNI	CTCAG	2 cut(s)	94, 858
BspLI	GGNNCC	2 cut(s)	29, 860
BspMAI	CTGCAG	1 cut(s)	567
BspMI	ACCTGC	2 cut(s)	38, 870
BspPI	GGATC	2 cut(s)	133, 342
BspQI	GCTCTTC	1 cut(s)	840
BspTNI	GGTCTC	1 cut(s)	580
BssECI	CCNNGG	3 cut(s)	244, 282, 854
BssMI	GATC	5 cut(s)	96, 125, 334, 484, 538
BssT1I	CCWWGG	3 cut(s)	244, 282, 854
Bst2UI	CCWGG	1 cut(s)	684
Bst4CI	ACNGT	4 cut(s)	217, 302, 403, 790
Bst6I	CTCTTC	1 cut(s)	840
BstC8I	GCNNGC	1 cut(s)	273
BstDEI	CTNAG	3 cut(s)	20, 102, 866
BstF5I	GGATG	3 cut(s)	63, 196, 466
BstKTI	GATC	5 cut(s)	99, 128, 337, 487, 541
BstMAI	GTCTC	1 cut(s)	580
BstMBI	GATC	5 cut(s)	96, 125, 334, 484, 538
BstNI	CCWGG	1 cut(s)	684
BstNSI	RCATGY	1 cut(s)	310
BstSCI	CCNGG	1 cut(s)	682
BstSFI	CTRYAG	1 cut(s)	563
BstV1I	GCAGC	3 cut(s)	262, 355, 663
BstX2I	RGATCY	1 cut(s)	334
BstYI	RGATCY	1 cut(s)	334
BsuI	GTATCC	2 cut(s)	391, 778
BsuRI	GGCC	2 cut(s)	243, 732
BtgZI	GCGATG	1 cut(s)	150
BtrI	CACGTC	1 cut(s)	94
BtsCI	GGATG	3 cut(s)	63, 196, 466
BtsI	GCAGTG	1 cut(s)	297
BtsIMutI	CAGTG	2 cut(s)	297, 534
BveI	ACCTGC	2 cut(s)	38, 870
Cac8I	GCNNGC	1 cut(s)	273
Cfr13I	GGNCC	1 cut(s)	28
CviAII	CATG	2 cut(s)	307, 340
DdeI	CTNAG	3 cut(s)	20, 102, 866
DpnI	GATC	5 cut(s)	98, 127, 336, 486, 540
DpnII	GATC	5 cut(s)	96, 125, 334, 484, 538
DraIII	CACNNNGTG	1 cut(s)	728
DriI	GACNNNNNGTC	1 cut(s)	390
EaeI	YGGCCR	2 cut(s)	241, 730
Eam1104I	CTCTTC	1 cut(s)	840
Eam1105I	GACNNNNNGTC	1 cut(s)	390
EarI	CTCTTC	1 cut(s)	840
EciI	GGCGGA	1 cut(s)	784
Eco130I	CCWWGG	3 cut(s)	244, 282, 854
Eco31I	GGTCTC	1 cut(s)	580
Eco47I	GGWCC	1 cut(s)	28
Eco57I	CTGAAG	1 cut(s)	92
EcoO109I	RGGNCCY	1 cut(s)	28
EcoRII	CCWGG	1 cut(s)	682
EcoT14I	CCWWGG	3 cut(s)	244, 282, 854
ErhI	CCWWGG	3 cut(s)	244, 282, 854
FaeI	CATG	2 cut(s)	310, 343
FatI	CATG	2 cut(s)	306, 339
Fnu4HI	GCNGC	3 cut(s)	276, 369, 652
FokI	GGATG	3 cut(s)	50, 203, 473
Fsp4HI	GCNGC	3 cut(s)	276, 369, 652
FspBI	CTAG	1 cut(s)	57
GluI	GCNGC	3 cut(s)	276, 369, 652
GsuI	CTGGAG	3 cut(s)	63, 537, 705
HaeIII	GGCC	2 cut(s)	243, 732
Hin1II	CATG	2 cut(s)	310, 343
HincII	GTYRAC	3 cut(s)	421, 560, 879
HindII	GTYRAC	3 cut(s)	421, 560, 879
HinfI	GANTC	3 cut(s)	149, 447, 556
HphI	GGTGA	1 cut(s)	158
Hpy166II	GTNNAC	3 cut(s)	421, 560, 879
Hpy188I	TCNGA	6 cut(s)	91, 142, 154, 334, 715, 751
Hpy188III	TCNNGA	6 cut(s)	129, 395, 451, 542, 584, 605
Hpy8I	GTNNAC	3 cut(s)	421, 560, 879
Hpy99I	CGWCG	1 cut(s)	95
HpyAV	CCTTC	3 cut(s)	41, 137, 310
HpyCH4III	ACNGT	4 cut(s)	217, 302, 403, 790
HpyCH4IV	ACGT	1 cut(s)	93
HpyCH4V	TGCA	8 cut(s)	10, 164, 206, 565, 651, 694, 722, 823
HpyF3I	CTNAG	3 cut(s)	20, 102, 866
HpySE526I	ACGT	1 cut(s)	93
Hsp92II	CATG	2 cut(s)	310, 343
Kzo9I	GATC	5 cut(s)	96, 125, 334, 484, 538
LguI	GCTCTTC	1 cut(s)	840
LmnI	GCTCC	3 cut(s)	44, 65, 686
Lsp1109I	GCAGC	3 cut(s)	262, 355, 663
LweI	GCATC	1 cut(s)	173
MaeI	CTAG	1 cut(s)	57
MaeII	ACGT	1 cut(s)	93
MaeIII	GTNAC	6 cut(s)	50, 248, 296, 302, 346, 373
MalI	GATC	5 cut(s)	98, 127, 336, 486, 540
MboI	GATC	5 cut(s)	96, 125, 334, 484, 538
MboII	GAAGA	4 cut(s)	439, 604, 620, 857
MflI	RGATCY	1 cut(s)	334
MlsI	TGGCCA	1 cut(s)	243
MluCI	AATT	6 cut(s)	12, 326, 454, 498, 709, 777
MluNI	TGGCCA	1 cut(s)	243
MlyI	GAGTC	1 cut(s)	565
MmeI	TCCRAC	2 cut(s)	114, 822
MnlI	CCTC	3 cut(s)	77, 861, 861
Mox20I	TGGCCA	1 cut(s)	243
MscI	TGGCCA	1 cut(s)	243
MseI	TTAA	5 cut(s)	324, 501, 549, 705, 771
MslI	CAYNNNNRTG	1 cut(s)	344
Msp20I	TGGCCA	1 cut(s)	243
MspA1I	CMGCKG	1 cut(s)	275
MspR9I	CCNGG	1 cut(s)	684
Mva1269I	GAATGC	1 cut(s)	232
MvaI	CCWGG	1 cut(s)	684
NdeII	GATC	5 cut(s)	96, 125, 334, 484, 538
NlaIII	CATG	2 cut(s)	310, 343
NlaIV	GGNNCC	2 cut(s)	29, 860
NmuCI	GTSAC	1 cut(s)	346
NspI	RCATGY	1 cut(s)	310
PciI	ACATGT	1 cut(s)	306
PciSI	GCTCTTC	1 cut(s)	840
PcsI	WCGNNNNNNNCGW	2 cut(s)	205, 730
PctI	GAATGC	1 cut(s)	232
PfeI	GAWTC	2 cut(s)	149, 447
PflMI	CCANNNNNTGG	1 cut(s)	457
PkrI	GCNGC	3 cut(s)	277, 370, 653
PleI	GAGTC	1 cut(s)	564
PpsI	GAGTC	1 cut(s)	564
PpuMI	RGGWCCY	1 cut(s)	28
PscI	ACATGT	1 cut(s)	306
Psp5II	RGGWCCY	1 cut(s)	28
Psp6I	CCWGG	1 cut(s)	682
PspGI	CCWGG	1 cut(s)	682
PspN4I	GGNNCC	2 cut(s)	29, 860
PspPI	GGNCC	1 cut(s)	28
PspPPI	RGGWCCY	1 cut(s)	28
PstI	CTGCAG	1 cut(s)	567
PsuI	RGATCY	1 cut(s)	334
PvuII	CAGCTG	1 cut(s)	275
RseI	CAYNNNNRTG	1 cut(s)	344
SapI	GCTCTTC	1 cut(s)	840
SaqAI	TTAA	5 cut(s)	324, 501, 549, 705, 771
SatI	GCNGC	3 cut(s)	276, 369, 652
Sau3AI	GATC	5 cut(s)	96, 125, 334, 484, 538
Sau96I	GGNCC	1 cut(s)	28
SchI	GAGTC	1 cut(s)	565
ScrFI	CCNGG	1 cut(s)	684
SfaNI	GCATC	1 cut(s)	173
SfcI	CTRYAG	1 cut(s)	563
SinI	GGWCC	1 cut(s)	28
SmiMI	CAYNNNNRTG	1 cut(s)	344
SmlI	CTYRAG	1 cut(s)	553
SmoI	CTYRAG	1 cut(s)	553
Sse9I	AATT	6 cut(s)	12, 326, 454, 498, 709, 777
SsiI	CCGC	2 cut(s)	782, 795
SspMI	CTAG	1 cut(s)	57
StyD4I	CCNGG	1 cut(s)	682
StyI	CCWWGG	3 cut(s)	244, 282, 854
TaaI	ACNGT	4 cut(s)	217, 302, 403, 790
TaiI	ACGT	1 cut(s)	96
TasI	AATT	6 cut(s)	12, 326, 454, 498, 709, 777
TfiI	GAWTC	2 cut(s)	149, 447
Tru1I	TTAA	5 cut(s)	324, 501, 549, 705, 771
Tru9I	TTAA	5 cut(s)	324, 501, 549, 705, 771
TscAI	CASTG	2 cut(s)	297, 541
TseFI	GTSAC	1 cut(s)	346
TseI	GCWGC	3 cut(s)	275, 368, 651
Tsp45I	GTSAC	1 cut(s)	346
TspRI	CASTG	2 cut(s)	297, 541
Van91I	CCANNNNNTGG	1 cut(s)	457
VpaK11BI	GGWCC	1 cut(s)	28
XapI	RAATTY	3 cut(s)	326, 454, 709
XceI	RCATGY	1 cut(s)	310
XspI	CTAG	1 cut(s)	57

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.