Rw7G024050

Protein of unknown function (DUF1664)

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
Physical Location & Seq
Reverse (-)
29359283 .. 29360062
780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G024050.1

Sequence Viewer

Length: 177 bp
ATGGGTGTTGCTTACCTTTGCAACTTTGTTGGTGGGAAAAAAGTTGAAATGCCTGGAGCTCTGCAGAAGCAACTTAAAAACTCTGATAATGCACGGGGTGGCCGATTACTCTCATATTCAGAACCAAAAATTGCAGATACTGTGTCTGCCCGTTTGAATAGTGAAGGCAGAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.18

Weight (kDa)

9.65

Isoelectric Point (pI)

22.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 100
AdeI CACNNNGTG 1 cut(s) 98
AgsI TTSAA 2 cut(s) 47, 157
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 61
AlwNI CAGNNNCTG 1 cut(s) 140
AoxI GGCC 1 cut(s) 100
BanII GRGCYC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 61
BciT130I CCWGG 1 cut(s) 54
BfmI CTRYAG 1 cut(s) 62
Bme1390I CCNGG 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 54
BpmI CTGGAG 1 cut(s) 75
BseBI CCWGG 1 cut(s) 54
BshFI GGCC 1 cut(s) 102
BsiHKAI GWGCWC 1 cut(s) 61
BsnI GGCC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 61
BspANI GGCC 1 cut(s) 102
BspMAI CTGCAG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 142
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 62
BsuRI GGCC 1 cut(s) 102
CaiI CAGNNNCTG 1 cut(s) 140
CviJI RGCY 2 cut(s) 59, 102
CviKI_1 RGCY 2 cut(s) 59, 102
DraIII CACNNNGTG 1 cut(s) 98
EaeI YGGCCR 1 cut(s) 100
Ecl136II GAGCTC 1 cut(s) 59
Eco24I GRGCYC 1 cut(s) 61
Eco53kI GAGCTC 1 cut(s) 59
EcoICRI GAGCTC 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 52
EcoT38I GRGCYC 1 cut(s) 61
FaiI YATR 1 cut(s) 115
FriOI GRGCYC 1 cut(s) 61
GsuI CTGGAG 1 cut(s) 75
HaeIII GGCC 1 cut(s) 102
Hpy188I TCNGA 2 cut(s) 85, 121
HpyAV CCTTC 1 cut(s) 158
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 4 cut(s) 21, 64, 92, 134
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 2 cut(s) 39, 66
MhlI GDGCHC 1 cut(s) 61
MluCI AATT 1 cut(s) 129
MnlI CCTC 1 cut(s) 164
MseI TTAA 1 cut(s) 75
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
PcsI WCGNNNNNNNCGW 1 cut(s) 100
Psp124BI GAGCTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PstI CTGCAG 1 cut(s) 66
PstNI CAGNNNCTG 1 cut(s) 140
SacI GAGCTC 1 cut(s) 61
SaqAI TTAA 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 54
SduI GDGCHC 1 cut(s) 61
SetI ASST 2 cut(s) 18, 61
SfcI CTRYAG 1 cut(s) 62
SgeI CNNG 5 cut(s) 65, 66, 105, 107, 162
Sse9I AATT 1 cut(s) 129
SstI GAGCTC 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 52
TaaI ACNGT 1 cut(s) 142
TasI AATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.