Rh4DG384500

Protein of unknown function (DUF1664)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0003884
Physical Location & Seq
Forward (+)
60192773 .. 60196630
3858 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG384500.1

Sequence Viewer

Length: 639 bp
ATGGCTATGCAAATTGGTCTTAGCAGGGTCCTTCTCATAGCTGGAGCAGGTTACACTAGCTCCATCCTCGTTAGGAACGGCAAATTCTCCGACGTGATCGCTGAGCTTCAGGCTTTGTTGAATGGATCAGGAGAGCAATCAGAAGGTGATTCTGATAAGATTGCATCGCAGATGTATAACCGATTGCTGGATGAGATACGCTCTGCACGACAAACAGTTGTACTGAATGCTAATGGGGGTGGCCAAGGTAATTTGACATCACTTATAGTGCCAGCTGCGACCTTGGGGGCAGTGGGTTACGGTTACATGTGGTGGAAGGGTCTTAAATTCTCGGATCTCATGTATGTGACAAAGCGTAATATGACTGCTGCTGTTACAAACTTGACAAAAAGTCTGGATACTGTAAAAGAAGCTGTTGTCAACACGAAGAAGCACCTGACACAGAGAATCCAGAATTTGGATGATAAAGTGCTGGAACAAAATGATCTCTCAAAGTCAATTAAGACTGATGTTGCTGGAGTTCAAAATTCTCTCACTGATCTGGACTTTAACTTGAGTCAACTGCAGAGCTTGGTCTCTGGTCTGGATTGGAAGATATGTTCTCTTGAAGAAAAGCAGGTAAACTGCTTGTTTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1664

Protein Analysis

212

Amino Acids

23.11

Weight (kDa)

6.59

Isoelectric Point (pI)

28.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1664 PF07889 83 - 206 6.9e-46 Protein of unknown function (DUF1664)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 38, 607
AccB7I CCANNNNNTGG 1 cut(s) 457
AclWI GGATC 2 cut(s) 133, 342
AcoI YGGCCR 1 cut(s) 241
AcsI RAATTY 4 cut(s) 83, 326, 454, 526
AcuI CTGAAG 1 cut(s) 92
AfaI GTAC 1 cut(s) 222
AfiI CCNNNNNNNGG 2 cut(s) 187, 457
AflIII ACRYGT 1 cut(s) 306
AgsI TTSAA 3 cut(s) 121, 524, 608
AhdI GACNNNNNGTC 1 cut(s) 390
AjiI CACGTC 1 cut(s) 94
AloI GAACNNNNNNTCC 2 cut(s) 583, 615
AluBI AGCT 6 cut(s) 41, 60, 106, 275, 413, 570
AluI AGCT 6 cut(s) 41, 60, 106, 275, 413, 570
Alw26I GTCTC 1 cut(s) 580
AlwI GGATC 2 cut(s) 133, 342
AoxI GGCC 1 cut(s) 241
ApeKI GCWGC 2 cut(s) 275, 368
ApoI RAATTY 4 cut(s) 83, 326, 454, 526
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 158
AvaII GGWCC 1 cut(s) 28
BalI TGGCCA 1 cut(s) 243
BbvI GCAGC 2 cut(s) 262, 355
BccI CCATC 1 cut(s) 71
BceAI ACGGC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 391
BcoDI GTCTC 1 cut(s) 580
BfaI CTAG 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 563
BfuAI ACCTGC 2 cut(s) 38, 607
BfuI GTATCC 1 cut(s) 391
BisI GCNGC 2 cut(s) 276, 369
BlpI GCTNAGC 1 cut(s) 102
BlsI GCNGC 2 cut(s) 277, 370
Bme18I GGWCC 1 cut(s) 28
BmeRI GACNNNNNGTC 1 cut(s) 390
BmgBI CACGTC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 29
BmsI GCATC 1 cut(s) 173
BplI GAGNNNNNCTC 2 cut(s) 185, 217
BpmI CTGGAG 2 cut(s) 63, 537
Bpu1102I GCTNAGC 1 cut(s) 102
BpuEI CTTGAG 1 cut(s) 574
BsaI GGTCTC 1 cut(s) 580
BsaJI CCNNGG 2 cut(s) 244, 282
BsaXI ACNNNNNCTCC 2 cut(s) 44, 74
Bsc4I CCNNNNNNNGG 2 cut(s) 187, 457
BseDI CCNNGG 2 cut(s) 244, 282
BseGI GGATG 3 cut(s) 63, 196, 466
BseLI CCNNNNNNNGG 2 cut(s) 187, 457
BseMII CTCAG 1 cut(s) 93
BseXI GCAGC 2 cut(s) 262, 355
BsgI GTGCAG 1 cut(s) 189
BshFI GGCC 1 cut(s) 243
BslI CCNNNNNNNGG 2 cut(s) 187, 457
BsmAI GTCTC 1 cut(s) 580
BsmI GAATGC 1 cut(s) 232
BsnI GGCC 1 cut(s) 243
Bso31I GGTCTC 1 cut(s) 580
Bsp143I GATC 5 cut(s) 96, 125, 334, 484, 538
Bsp1720I GCTNAGC 1 cut(s) 102
BspANI GGCC 1 cut(s) 243
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 29
BspMAI CTGCAG 1 cut(s) 567
BspMI ACCTGC 2 cut(s) 38, 607
BspPI GGATC 2 cut(s) 133, 342
BspTNI GGTCTC 1 cut(s) 580
BssECI CCNNGG 2 cut(s) 244, 282
BssMI GATC 5 cut(s) 96, 125, 334, 484, 538
BssT1I CCWWGG 2 cut(s) 244, 282
Bst4CI ACNGT 3 cut(s) 217, 302, 403
BstC8I GCNNGC 1 cut(s) 273
BstDEI CTNAG 2 cut(s) 20, 102
BstF5I GGATG 3 cut(s) 63, 196, 466
BstKTI GATC 5 cut(s) 99, 128, 337, 487, 541
BstMAI GTCTC 1 cut(s) 580
BstMBI GATC 5 cut(s) 96, 125, 334, 484, 538
BstNSI RCATGY 1 cut(s) 310
BstSFI CTRYAG 1 cut(s) 563
BstV1I GCAGC 2 cut(s) 262, 355
BstX2I RGATCY 1 cut(s) 334
BstYI RGATCY 1 cut(s) 334
BsuI GTATCC 1 cut(s) 391
BsuRI GGCC 1 cut(s) 243
BtgZI GCGATG 1 cut(s) 150
BtrI CACGTC 1 cut(s) 94
BtsCI GGATG 3 cut(s) 63, 196, 466
BtsI GCAGTG 1 cut(s) 297
BtsIMutI CAGTG 2 cut(s) 297, 534
BveI ACCTGC 2 cut(s) 38, 607
Cac8I GCNNGC 1 cut(s) 273
Cfr13I GGNCC 1 cut(s) 28
Csp6I GTAC 1 cut(s) 221
CviAII CATG 2 cut(s) 307, 340
CviJI RGCY 9 cut(s) 5, 41, 60, 106, 113, 243, 275, 413, 570
CviKI_1 RGCY 9 cut(s) 5, 41, 60, 106, 113, 243, 275, 413, 570
CviQI GTAC 1 cut(s) 221
DdeI CTNAG 2 cut(s) 20, 102
DpnI GATC 5 cut(s) 98, 127, 336, 486, 540
DpnII GATC 5 cut(s) 96, 125, 334, 484, 538
DriI GACNNNNNGTC 1 cut(s) 390
EaeI YGGCCR 1 cut(s) 241
Eam1105I GACNNNNNGTC 1 cut(s) 390
Eco130I CCWWGG 2 cut(s) 244, 282
Eco31I GGTCTC 1 cut(s) 580
Eco47I GGWCC 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 92
EcoO109I RGGNCCY 1 cut(s) 28
EcoT14I CCWWGG 2 cut(s) 244, 282
ErhI CCWWGG 2 cut(s) 244, 282
FaeI CATG 2 cut(s) 310, 343
FaiI YATR 9 cut(s) 8, 38, 177, 266, 308, 341, 345, 362, 598
FatI CATG 2 cut(s) 306, 339
Fnu4HI GCNGC 2 cut(s) 276, 369
FokI GGATG 3 cut(s) 50, 203, 473
Fsp4HI GCNGC 2 cut(s) 276, 369
FspBI CTAG 1 cut(s) 57
GluI GCNGC 2 cut(s) 276, 369
GsuI CTGGAG 2 cut(s) 63, 537
HaeIII GGCC 1 cut(s) 243
Hin1II CATG 2 cut(s) 310, 343
HincII GTYRAC 2 cut(s) 421, 560
HindII GTYRAC 2 cut(s) 421, 560
HinfI GANTC 3 cut(s) 149, 447, 556
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 3 cut(s) 421, 560, 622
Hpy188I TCNGA 4 cut(s) 91, 142, 154, 334
Hpy188III TCNNGA 6 cut(s) 129, 395, 451, 542, 584, 605
Hpy8I GTNNAC 3 cut(s) 421, 560, 622
Hpy99I CGWCG 1 cut(s) 95
HpyAV CCTTC 3 cut(s) 41, 137, 310
HpyCH4III ACNGT 3 cut(s) 217, 302, 403
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 4 cut(s) 10, 164, 206, 565
HpyF3I CTNAG 2 cut(s) 20, 102
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 2 cut(s) 310, 343
Kzo9I GATC 5 cut(s) 96, 125, 334, 484, 538
LmnI GCTCC 2 cut(s) 44, 65
Lsp1109I GCAGC 2 cut(s) 262, 355
LweI GCATC 1 cut(s) 173
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 5 cut(s) 50, 296, 302, 346, 373
MalI GATC 5 cut(s) 98, 127, 336, 486, 540
MboI GATC 5 cut(s) 96, 125, 334, 484, 538
MboII GAAGA 3 cut(s) 439, 604, 620
MflI RGATCY 1 cut(s) 334
MlsI TGGCCA 1 cut(s) 243
MluCI AATT 7 cut(s) 12, 83, 250, 326, 454, 498, 526
MluNI TGGCCA 1 cut(s) 243
MlyI GAGTC 1 cut(s) 565
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 1 cut(s) 77
Mox20I TGGCCA 1 cut(s) 243
MscI TGGCCA 1 cut(s) 243
MseI TTAA 3 cut(s) 324, 501, 549
MslI CAYNNNNRTG 1 cut(s) 344
Msp20I TGGCCA 1 cut(s) 243
MspA1I CMGCKG 1 cut(s) 275
Mva1269I GAATGC 1 cut(s) 232
NdeII GATC 5 cut(s) 96, 125, 334, 484, 538
NlaIII CATG 2 cut(s) 310, 343
NlaIV GGNNCC 1 cut(s) 29
NmuCI GTSAC 1 cut(s) 346
NspI RCATGY 1 cut(s) 310
PciI ACATGT 1 cut(s) 306
PcsI WCGNNNNNNNCGW 1 cut(s) 205
PctI GAATGC 1 cut(s) 232
PfeI GAWTC 2 cut(s) 149, 447
PflMI CCANNNNNTGG 1 cut(s) 457
PkrI GCNGC 2 cut(s) 277, 370
PleI GAGTC 1 cut(s) 564
PpsI GAGTC 1 cut(s) 564
PpuMI RGGWCCY 1 cut(s) 28
PscI ACATGT 1 cut(s) 306
Psp5II RGGWCCY 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 28
PspPPI RGGWCCY 1 cut(s) 28
PstI CTGCAG 1 cut(s) 567
PsuI RGATCY 1 cut(s) 334
PvuII CAGCTG 1 cut(s) 275
RsaI GTAC 1 cut(s) 222
RsaNI GTAC 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 344
SaqAI TTAA 3 cut(s) 324, 501, 549
SatI GCNGC 2 cut(s) 276, 369
Sau3AI GATC 5 cut(s) 96, 125, 334, 484, 538
Sau96I GGNCC 1 cut(s) 28
SchI GAGTC 1 cut(s) 565
SfaNI GCATC 1 cut(s) 173
SfcI CTRYAG 1 cut(s) 563
SinI GGWCC 1 cut(s) 28
SmiMI CAYNNNNRTG 1 cut(s) 344
SmlI CTYRAG 1 cut(s) 553
SmoI CTYRAG 1 cut(s) 553
Sse9I AATT 7 cut(s) 12, 83, 250, 326, 454, 498, 526
SspMI CTAG 1 cut(s) 57
StyI CCWWGG 2 cut(s) 244, 282
TaaI ACNGT 3 cut(s) 217, 302, 403
TaiI ACGT 1 cut(s) 96
TasI AATT 7 cut(s) 12, 83, 250, 326, 454, 498, 526
TatI WGTACW 1 cut(s) 220
TfiI GAWTC 2 cut(s) 149, 447
Tru1I TTAA 3 cut(s) 324, 501, 549
Tru9I TTAA 3 cut(s) 324, 501, 549
TscAI CASTG 2 cut(s) 297, 541
TseFI GTSAC 1 cut(s) 346
TseI GCWGC 2 cut(s) 275, 368
Tsp45I GTSAC 1 cut(s) 346
TspRI CASTG 2 cut(s) 297, 541
Van91I CCANNNNNTGG 1 cut(s) 457
VpaK11BI GGWCC 1 cut(s) 28
XapI RAATTY 4 cut(s) 83, 326, 454, 526
XceI RCATGY 1 cut(s) 310
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.