pycom13g08360

Involved in the biosynthesis of phylloquinone (vitamin K1). Methyltransferase required for the conversion of 2-phytyl- 1,4-beta-naphthoquinol to phylloquinol

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
5558738 .. 5559170
433 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g08360.2

Sequence Viewer

Length: 195 bp
ATGATTGACAATCTTGTTGTCCCGGTGGCTTCTGGTTTTGGACTTGAGGACGATTACAAGTATTTAAAGAGTTCAGTCAGGGCATTCCTGACAGGGGACGAGTTGGAGAACCTGGCTTTAGACGTAGGTTTTTCCAATGCCAGATATTATGAGATTGGCAGAAGCCTCATAGGGAACTTAGTAGCCACACGATAG

Protein Analysis

65

Amino Acids

7.06

Weight (kDa)

4.56

Isoelectric Point (pI)

26.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 94
AjnI CCWGG 1 cut(s) 111
AsuC2I CCSGG 1 cut(s) 23
BciT130I CCWGG 1 cut(s) 113
BcnI CCSGG 1 cut(s) 23
Bme1390I CCNGG 2 cut(s) 23, 113
BmrFI CCNGG 2 cut(s) 23, 113
BpuEI CTTGAG 1 cut(s) 65
BpuMI CCSGG 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 94
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 2 cut(s) 5, 110
BslI CCNNNNNNNGG 1 cut(s) 94
BsmFI GGGAC 2 cut(s) 5, 110
BsmI GAATGC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 178
BstNI CCWGG 1 cut(s) 113
BstSCI CCNGG 2 cut(s) 21, 111
CviJI RGCY 4 cut(s) 29, 116, 165, 185
CviKI_1 RGCY 4 cut(s) 29, 116, 165, 185
DdeI CTNAG 1 cut(s) 178
DraI TTTAAA 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 111
FaiI YATR 2 cut(s) 150, 170
FaqI GGGAC 2 cut(s) 5, 110
HapII CCGG 1 cut(s) 23
HpaII CCGG 1 cut(s) 23
Hpy188III TCNNGA 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 123
HpyF3I CTNAG 1 cut(s) 178
HpySE526I ACGT 1 cut(s) 123
LpnPI CCDG 8 cut(s) 18, 36, 64, 78, 98, 101, 125, 154
MaeII ACGT 1 cut(s) 123
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 2 cut(s) 40, 176
MseI TTAA 1 cut(s) 65
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 2 cut(s) 23, 113
Mva1269I GAATGC 1 cut(s) 83
MvaI CCWGG 1 cut(s) 113
NciI CCSGG 1 cut(s) 23
PctI GAATGC 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
SaqAI TTAA 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 23, 113
SetI ASST 3 cut(s) 114, 126, 130
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
StyD4I CCNGG 2 cut(s) 21, 111
TaiI ACGT 1 cut(s) 126
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.