RchiOBHm_Chr4g0399091

Leucine rich repeat

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
16213771 .. 16214249
479 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGAAGGATTTTGGGAGAACACGATTATGTCTCGGTTTGGAACTTGAGCATCGTGTCGATAGATGCTTAGGCATTTTTGACAAGGTCAAGCCTTCAAGCACCCCTATGATCGTCCGTAGTCTTGATCCTGAAAAGGATCCTCTTCGTCGAAAGGATGATGACGAAGATGTGCTAGAGGCAAAAGTGCCTTACTTAGTACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.78

Weight (kDa)

5.75

Isoelectric Point (pI)

34.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 119, 131, 144
AfaI GTAC 1 cut(s) 198
AgsI TTSAA 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 35
AlwI GGATC 3 cut(s) 119, 131, 144
BamHI GGATCC 1 cut(s) 136
BcoDI GTCTC 1 cut(s) 35
BfaI CTAG 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 138
BmsI GCATC 2 cut(s) 53, 58
Bpu10I CCTNAGC 1 cut(s) 67
BpuEI CTTGAG 1 cut(s) 65
BseGI GGATG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 35
Bsp143I GATC 3 cut(s) 108, 124, 136
BspLI GGNNCC 1 cut(s) 138
BspPI GGATC 3 cut(s) 119, 131, 144
BssMI GATC 3 cut(s) 108, 124, 136
Bst6I CTCTTC 1 cut(s) 147
BstDEI CTNAG 2 cut(s) 67, 193
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 3 cut(s) 111, 127, 139
BstMAI GTCTC 1 cut(s) 35
BstMBI GATC 3 cut(s) 108, 124, 136
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BtsCI GGATG 1 cut(s) 160
Csp6I GTAC 1 cut(s) 197
CviJI RGCY 1 cut(s) 91
CviKI_1 RGCY 1 cut(s) 91
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 2 cut(s) 67, 193
DpnI GATC 3 cut(s) 110, 126, 138
DpnII GATC 3 cut(s) 108, 124, 136
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
FaiI YATR 2 cut(s) 28, 107
FokI GGATG 1 cut(s) 167
FspBI CTAG 1 cut(s) 173
Hpy188III TCNNGA 2 cut(s) 122, 128
Hpy99I CGWCG 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 102
HpyF3I CTNAG 2 cut(s) 67, 193
Kzo9I GATC 3 cut(s) 108, 124, 136
LpnPI CCDG 1 cut(s) 141
LweI GCATC 2 cut(s) 53, 58
MaeI CTAG 1 cut(s) 173
MalI GATC 3 cut(s) 110, 126, 138
MboI GATC 3 cut(s) 108, 124, 136
MboII GAAGA 2 cut(s) 134, 176
MflI RGATCY 1 cut(s) 136
MnlI CCTC 2 cut(s) 150, 169
MslI CAYNNNNRTG 2 cut(s) 25, 104
NdeII GATC 3 cut(s) 108, 124, 136
NlaIV GGNNCC 1 cut(s) 138
PflFI GACNNNGTC 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 138
PsuI RGATCY 1 cut(s) 136
PsyI GACNNNGTC 1 cut(s) 83
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
RseI CAYNNNNRTG 2 cut(s) 25, 104
Sau3AI GATC 3 cut(s) 108, 124, 136
SetI ASST 1 cut(s) 87
SfaNI GCATC 2 cut(s) 53, 58
SmiMI CAYNNNNRTG 2 cut(s) 25, 104
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SspMI CTAG 1 cut(s) 173
TaqI TCGA 2 cut(s) 57, 148
TatI WGTACW 1 cut(s) 196
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 104
Tth111I GACNNNGTC 1 cut(s) 83
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.