Rroxscaffold_3G00229100

Leucine rich repeat

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0003281
Physical Location & Seq
Reverse (-)
13612898 .. 13614730
1833 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00229100.1

Sequence Viewer

Length: 237 bp
ATGCTTAGGCATTTTGACAAGGTCAAGCCTTCAAGTACCCCCATCATCGTCCATAGTCTTGATCCCGAAAAGGATTTTCTTCATTTAAGGGATGATGACGAAGATGTGCTAGAGGCAAGAGTGTCTTACTTGAGTACAATAGGCACATTATTGTTGCGTCCAGCCAATAATGAGATGCCTCCTCGCAAGACAAGACAAGGCACACCTAAAGTGCAAGCCGGGACAAAGCCCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

78

Amino Acids

8.82

Weight (kDa)

8.12

Isoelectric Point (pI)

33.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 56
AfaI GTAC 2 cut(s) 37, 136
AgsI TTSAA 1 cut(s) 33
AlwI GGATC 1 cut(s) 56
AsuC2I CCSGG 1 cut(s) 220
BccI CCATC 1 cut(s) 50
BcnI CCSGG 1 cut(s) 220
BfaI CTAG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 220
BmrFI CCNGG 1 cut(s) 220
BmsI GCATC 1 cut(s) 165
Bpu10I CCTNAGC 1 cut(s) 5
BpuEI CTTGAG 1 cut(s) 151
BpuMI CCSGG 1 cut(s) 220
BseGI GGATG 1 cut(s) 97
BseRI GAGGAG 1 cut(s) 171
BsiSI CCGG 1 cut(s) 219
Bsp143I GATC 1 cut(s) 61
BspPI GGATC 1 cut(s) 56
BssMI GATC 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 216
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 218
BtsCI GGATG 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 216
CseI GACGC 1 cut(s) 146
Csp6I GTAC 2 cut(s) 36, 135
CviJI RGCY 4 cut(s) 28, 164, 218, 229
CviKI_1 RGCY 4 cut(s) 28, 164, 218, 229
CviQI GTAC 2 cut(s) 36, 135
DdeI CTNAG 1 cut(s) 5
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
FaiI YATR 1 cut(s) 54
FalI AAGNNNNNCTT 2 cut(s) 109, 141
FokI GGATG 1 cut(s) 104
FspBI CTAG 1 cut(s) 110
HapII CCGG 1 cut(s) 219
HgaI GACGC 1 cut(s) 146
HpaII CCGG 1 cut(s) 219
Hpy188III TCNNGA 2 cut(s) 59, 65
HpyAV CCTTC 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 214
HpyF3I CTNAG 1 cut(s) 5
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 2 cut(s) 174, 232
LweI GCATC 1 cut(s) 165
MaeI CTAG 1 cut(s) 110
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 2 cut(s) 71, 113
MnlI CCTC 3 cut(s) 106, 189, 192
MseI TTAA 1 cut(s) 86
MspI CCGG 1 cut(s) 219
MspR9I CCNGG 1 cut(s) 220
NciI CCSGG 1 cut(s) 220
NdeII GATC 1 cut(s) 61
PflFI GACNNNGTC 1 cut(s) 20
PsyI GACNNNGTC 1 cut(s) 20
RsaI GTAC 2 cut(s) 37, 136
RsaNI GTAC 2 cut(s) 36, 135
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 220
SetI ASST 3 cut(s) 24, 208, 236
SfaNI GCATC 1 cut(s) 165
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 218
TatI WGTACW 1 cut(s) 134
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 71
Tth111I GACNNNGTC 1 cut(s) 20
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.