Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000335.1

Orthogroup ID

OG0003281

Physical Location & Seq

Genomic Coordinates Forward (+)

148697 .. 155549

Gene Structure 6853 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000335.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1134 bp

atgttcagcaataacgataggaattgtcgtagtctgtccccactatgtctcatcacgatccccgttaaagtgacgagatcacacaaatatgttgcaaacaagcctgcaaggaaggacgtccctacgagaggacgtagcgccaccctacatgaaggtaggcatggcgccaatgccaaagagagtggcactctggagttacaggtcatggccccagctaggatgtgtgggaggcccgtgggttcgaaggatactttggtacattctaatcctttgatcatcaagactcaaaattcgtctcatgagaatcatccggttattgttgggggacgccttaacgatgatgacgaagatgtgctacgggcaggagtgccttacttgagtacaataggcgcattattgtacttagctcaatgcacaagaccagacatctcatatggtagtgaacttgcttgttctatccctacagagagactatggattcagacccatcacacaccagaaacgccgccaacactggcctgcgtccattatccccatcccaaaatgataagcgttttggaaggttttactgatgttgggtatctctttgactcacacaaagagtctggtaggtgtcggcggtcggcgggccaacttcgatggatgagatcggaggttggtggattggaacggcgatggtcgtcgttgatcattgatggttggacagcgtcgaagcctgacgctagtgctggggaggtggacttggaggcgacaagttgcagcctttgccttgggcagggagggacgagtgacaagtttttatggctatgctcgaactggggaaagggatcgttaagagatctgtcagaccttggttctttgccttggatcgtgatcggagactttaatgaaatattgaacaatggagaaaagattgcaggtcctcttagactggagcgccagatgaggggttttcatgcagcattggggtattgcgatatcttggatttagggtttcatggtgcgatggccacatggtggaattcagaaactcttctgcttttggataaagctgtctgcacgccttcgtggtttgatatcacatgtgaagctagttcactttcctccttcggactcatgtccctcttcttctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4283 RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

377

Amino Acids

41.5

Weight (kDa)

6.67

Isoelectric Point (pI)

46.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003281)

Species	Orthologous Gene IDs
pyrus_communis	pycom17g17420
rosa_chinensis	RchiOBHm_Chr4g0399091 RchiOBHm_Chr4g0421941 RchiOBHm_Chr5g0007901
rosa_multiflora	Rmu_sc0000335.1_g000036 Rmu_sc0000356.1_g000003 Rmu_sc0000805.1_g000052 Rmu_sc0000821.1_g000003 Rmu_sc0000929.1_g000005 Rmu_sc0001023.1_g000028 Rmu_sc0001231.1_g000008 Rmu_sc0001575.1_g000023 Rmu_sc0001824.1_g000010 Rmu_sc0001844.1_g000026 Rmu_sc0002501.1_g000014 Rmu_sc0002607.1_g000033 Rmu_sc0002741.1_g000022 Rmu_sc0003002.1_g000053 Rmu_sc0003221.1_g000088 Rmu_sc0004485.1_g000019 Rmu_sc0004927.1_g000032 Rmu_sc0005065.1_g000012 Rmu_sc0005433.1_g000006 Rmu_sc0005645.1_g000014 Rmu_sc0007038.1_g000008 Rmu_sc0008582.1_g000003 Rmu_sc0008923.1_g000001 Rmu_sc0009255.1_g000009 Rmu_sc0013071.1_g000002 Rmu_sc0015943.1_g000001 Rmu_sc0015988.1_g000002 Rmu_sc0027076.1_g000002 Rmu_sc0027506.1_g000005 Rmu_ssc0000044.1_g000004
rosa_roxburghii	Rroxscaffold_3G00229100
rosa_rugosa	Rorug06G0164600 Rorug06G0164600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	120
Acc36I	ACCTGC	1 cut(s)	908
AccB1I	GGYRCC	1 cut(s)	164
AccB7I	CCANNNNNTGG	1 cut(s)	1017
AciI	CCGC	3 cut(s)	506, 619, 626
AclWI	GGATC	3 cut(s)	52, 835, 875
AcoI	YGGCCR	1 cut(s)	1008
AcsI	RAATTY	2 cut(s)	289, 1021
AcyI	GRCGYC	3 cut(s)	117, 165, 328
AdeI	CACNNNGTG	1 cut(s)	1017
AfaI	GTAC	3 cut(s)	258, 382, 401
AfiI	CCNNNNNNNGG	5 cut(s)	128, 216, 775, 946, 1017
AflIII	ACRYGT	1 cut(s)	1082
AgsI	TTSAA	1 cut(s)	898
AjuI	GAANNNNNNNTTGG	2 cut(s)	236, 268
AluBI	AGCT	4 cut(s)	215, 407, 1052, 1091
AluI	AGCT	4 cut(s)	215, 407, 1052, 1091
Alw26I	GTCTC	4 cut(s)	53, 300, 463, 873
AlwI	GGATC	3 cut(s)	52, 835, 875
AoxI	GGCC	5 cut(s)	207, 230, 516, 628, 1008
ApeKI	GCWGC	2 cut(s)	759, 959
ApoI	RAATTY	2 cut(s)	289, 1021
ArsI	GACNNNNNNTTYG	2 cut(s)	274, 306
Asp700I	GAANNNNTTC	1 cut(s)	1032
AspLEI	GCGC	4 cut(s)	140, 167, 392, 939
AspS9I	GGNCC	4 cut(s)	208, 231, 628, 920
AsuII	TTCGAA	1 cut(s)	242
AvaII	GGWCC	1 cut(s)	920
BaeI	ACNNNNGTAYC	2 cut(s)	240, 273
BalI	TGGCCA	1 cut(s)	1010
BanI	GGYRCC	1 cut(s)	164
BarI	GAAGNNNNNNTAC	2 cut(s)	339, 371
BbvI	GCAGC	2 cut(s)	771, 971
BccI	CCATC	6 cut(s)	495, 543, 633, 669, 689, 1000
BceAI	ACGGC	1 cut(s)	686
BciVI	GTATCC	1 cut(s)	241
BclI	TGATCA	2 cut(s)	273, 687
BcoDI	GTCTC	4 cut(s)	53, 300, 463, 873
BfaI	CTAG	3 cut(s)	216, 723, 1092
BfmI	CTRYAG	1 cut(s)	462
BfoI	RGCGCY	3 cut(s)	141, 168, 940
BfuAI	ACCTGC	1 cut(s)	908
BfuI	GTATCC	1 cut(s)	241
BglII	AGATCT	1 cut(s)	838
BisI	GCNGC	3 cut(s)	506, 760, 960
BlsI	GCNGC	3 cut(s)	507, 761, 961
Bme18I	GGWCC	1 cut(s)	920
BmgT120I	GGNCC	4 cut(s)	208, 231, 628, 920
BmiI	GGNNCC	2 cut(s)	166, 210
BmrI	ACTGGG	1 cut(s)	826
BmuI	ACTGGG	1 cut(s)	826
BoxI	GACNNNNGTC	1 cut(s)	1117
BplI	GAGNNNNNCTC	2 cut(s)	172, 204
BpmI	CTGGAG	2 cut(s)	212, 953
Bpu14I	TTCGAA	1 cut(s)	242
BpuEI	CTTGAG	1 cut(s)	397
BsaBI	GATNNNNATC	1 cut(s)	872
BsaHI	GRCGYC	3 cut(s)	117, 165, 328
BsaJI	CCNNGG	4 cut(s)	234, 769, 850, 863
BsaWI	WCCGGW	1 cut(s)	310
Bsc4I	CCNNNNNNNGG	5 cut(s)	128, 216, 775, 946, 1017
Bse1I	ACTGG	3 cut(s)	519, 821, 936
Bse8I	GATNNNNATC	1 cut(s)	872
BseDI	CCNNGG	4 cut(s)	234, 769, 850, 863
BseGI	GGATG	4 cut(s)	225, 307, 535, 648
BseJI	GATNNNNATC	1 cut(s)	872
BseLI	CCNNNNNNNGG	5 cut(s)	128, 216, 775, 946, 1017
BseNI	ACTGG	3 cut(s)	519, 821, 936
BseXI	GCAGC	2 cut(s)	771, 971
BseYI	CCCAGC	2 cut(s)	211, 728
BsgI	GTGCAG	1 cut(s)	1042
Bsh1285I	CGRYCG	1 cut(s)	623
BshFI	GGCC	5 cut(s)	209, 232, 518, 630, 1010
BshNI	GGYRCC	1 cut(s)	164
BsiEI	CGRYCG	1 cut(s)	623
BsiSI	CCGG	1 cut(s)	311
BslFI	GGGAC	5 cut(s)	22, 104, 339, 796, 1105
BslI	CCNNNNNNNGG	5 cut(s)	128, 216, 775, 946, 1017
BsmAI	GTCTC	4 cut(s)	53, 300, 463, 873
BsmBI	CGTCTC	1 cut(s)	300
BsmFI	GGGAC	5 cut(s)	22, 104, 339, 796, 1105
BsnI	GGCC	5 cut(s)	209, 232, 518, 630, 1010
Bsp119I	TTCGAA	1 cut(s)	242
Bsp143I	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
BspACI	CCGC	3 cut(s)	506, 619, 626
BspANI	GGCC	5 cut(s)	209, 232, 518, 630, 1010
BspHI	TCATGA	1 cut(s)	298
BspLI	GGNNCC	2 cut(s)	166, 210
BspMI	ACCTGC	1 cut(s)	908
BspPI	GGATC	3 cut(s)	52, 835, 875
BspT104I	TTCGAA	1 cut(s)	242
BspT107I	GGYRCC	1 cut(s)	164
BsrI	ACTGG	3 cut(s)	519, 821, 936
BssECI	CCNNGG	4 cut(s)	234, 769, 850, 863
BssMI	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
BssNI	GRCGYC	3 cut(s)	117, 165, 328
BssT1I	CCWWGG	3 cut(s)	769, 850, 863
Bst6I	CTCTTC	2 cut(s)	1038, 1130
BstACI	GRCGYC	3 cut(s)	117, 165, 328
BstAPI	GCANNNNNTGC	1 cut(s)	765
BstBI	TTCGAA	1 cut(s)	242
BstC8I	GCNNGC	4 cut(s)	105, 520, 628, 1061
BstDEI	CTNAG	2 cut(s)	403, 926
BstDSI	CCRYGG	1 cut(s)	234
BstENI	CCTNNNNNAGG	2 cut(s)	126, 773
BstF5I	GGATG	4 cut(s)	225, 307, 535, 648
BstH2I	RGCGCY	3 cut(s)	141, 168, 940
BstHHI	GCGC	4 cut(s)	140, 167, 392, 939
BstKTI	GATC	9 cut(s)	60, 80, 276, 650, 690, 830, 841, 870, 876
BstMAI	GTCTC	4 cut(s)	53, 300, 463, 873
BstMBI	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
BstMCI	CGRYCG	1 cut(s)	623
BstMWI	GCNNNNNNNGC	1 cut(s)	765
BstNSI	RCATGY	1 cut(s)	1086
BstPAI	GACNNNNGTC	1 cut(s)	1117
BstSFI	CTRYAG	1 cut(s)	462
BstV1I	GCAGC	2 cut(s)	771, 971
BstX2I	RGATCY	1 cut(s)	838
BstYI	RGATCY	1 cut(s)	838
BsuI	GTATCC	1 cut(s)	241
BsuRI	GGCC	5 cut(s)	209, 232, 518, 630, 1010
BtgI	CCRYGG	1 cut(s)	234
BtgZI	GCGATG	2 cut(s)	688, 1019
BtsCI	GGATG	4 cut(s)	225, 307, 535, 648
BtsIMutI	CAGTG	1 cut(s)	512
BveI	ACCTGC	1 cut(s)	908
Cac8I	GCNNGC	4 cut(s)	105, 520, 628, 1061
CciI	TCATGA	1 cut(s)	298
CfoI	GCGC	4 cut(s)	140, 167, 392, 939
Cfr13I	GGNCC	4 cut(s)	208, 231, 628, 920
CseI	GACGC	4 cut(s)	336, 511, 696, 728
Csp6I	GTAC	3 cut(s)	257, 381, 400
CspCI	CAANNNNNGTGG	2 cut(s)	163, 198
CviAII	CATG	9 cut(s)	149, 161, 205, 299, 956, 998, 1014, 1083, 1117
CviQI	GTAC	3 cut(s)	257, 381, 400
DdeI	CTNAG	2 cut(s)	403, 926
DinI	GGCGCC	1 cut(s)	166
DpnI	GATC	9 cut(s)	59, 79, 275, 649, 689, 829, 840, 869, 875
DpnII	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
DraIII	CACNNNGTG	1 cut(s)	1017
EaeI	YGGCCR	1 cut(s)	1008
Eam1104I	CTCTTC	2 cut(s)	1038, 1130
EarI	CTCTTC	2 cut(s)	1038, 1130
Eco130I	CCWWGG	3 cut(s)	769, 850, 863
Eco32I	GATATC	2 cut(s)	979, 1078
Eco47I	GGWCC	1 cut(s)	920
EcoNI	CCTNNNNNAGG	2 cut(s)	126, 773
EcoO109I	RGGNCCY	1 cut(s)	920
EcoRI	GAATTC	1 cut(s)	1021
EcoRV	GATATC	2 cut(s)	979, 1078
EcoT14I	CCWWGG	3 cut(s)	769, 850, 863
EgeI	GGCGCC	1 cut(s)	166
EheI	GGCGCC	1 cut(s)	166
ErhI	CCWWGG	3 cut(s)	769, 850, 863
Esp3I	CGTCTC	1 cut(s)	300
FaeI	CATG	9 cut(s)	152, 164, 208, 302, 959, 1001, 1017, 1086, 1120
FaqI	GGGAC	5 cut(s)	22, 104, 339, 796, 1105
FatI	CATG	9 cut(s)	148, 160, 204, 298, 955, 997, 1013, 1082, 1116
FauI	CCCGC	1 cut(s)	619
FauNDI	CATATG	1 cut(s)	433
FbaI	TGATCA	2 cut(s)	273, 687
Fnu4HI	GCNGC	3 cut(s)	506, 760, 960
FokI	GGATG	4 cut(s)	232, 294, 522, 655
Fsp4HI	GCNGC	3 cut(s)	506, 760, 960
FspBI	CTAG	3 cut(s)	216, 723, 1092
GlaI	GCGC	4 cut(s)	139, 166, 391, 938
GluI	GCNGC	3 cut(s)	506, 760, 960
GsaI	CCCAGC	2 cut(s)	215, 732
GsuI	CTGGAG	2 cut(s)	212, 953
HaeII	RGCGCY	3 cut(s)	141, 168, 940
HaeIII	GGCC	5 cut(s)	209, 232, 518, 630, 1010
HapII	CCGG	1 cut(s)	311
HgaI	GACGC	4 cut(s)	336, 511, 696, 728
HhaI	GCGC	4 cut(s)	140, 167, 392, 939
Hin1I	GRCGYC	3 cut(s)	117, 165, 328
Hin1II	CATG	9 cut(s)	152, 164, 208, 302, 959, 1001, 1017, 1086, 1120
Hin6I	GCGC	4 cut(s)	138, 165, 390, 937
HinP1I	GCGC	4 cut(s)	138, 165, 390, 937
HinfI	GANTC	6 cut(s)	283, 304, 478, 590, 602, 1113
HpaII	CCGG	1 cut(s)	311
Hpy166II	GTNNAC	3 cut(s)	443, 739, 1097
Hpy188I	TCNGA	7 cut(s)	483, 652, 847, 878, 1027, 1112, 1133
Hpy188III	TCNNGA	5 cut(s)	55, 191, 280, 299, 871
Hpy8I	GTNNAC	3 cut(s)	443, 739, 1097
Hpy99I	CGWCG	2 cut(s)	685, 712
HpyAV	CCTTC	6 cut(s)	106, 146, 238, 554, 1074, 1117
HpyCH4IV	ACGT	2 cut(s)	117, 133
HpyCH4V	TGCA	7 cut(s)	95, 107, 414, 759, 917, 959, 1059
HpyF10VI	GCNNNNNNNGC	1 cut(s)	765
HpyF3I	CTNAG	2 cut(s)	403, 926
HpySE526I	ACGT	2 cut(s)	117, 133
Hsp92I	GRCGYC	3 cut(s)	117, 165, 328
Hsp92II	CATG	9 cut(s)	152, 164, 208, 302, 959, 1001, 1017, 1086, 1120
HspAI	GCGC	4 cut(s)	138, 165, 390, 937
KasI	GGCGCC	1 cut(s)	164
Ksp22I	TGATCA	2 cut(s)	273, 687
Kzo9I	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
LmnI	GCTCC	1 cut(s)	934
Lsp1109I	GCAGC	2 cut(s)	771, 971
MaeI	CTAG	3 cut(s)	216, 723, 1092
MaeII	ACGT	2 cut(s)	117, 133
MaeIII	GTNAC	3 cut(s)	70, 195, 788
MalI	GATC	9 cut(s)	59, 79, 275, 649, 689, 829, 840, 869, 875
MboI	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
MboII	GAAGA	4 cut(s)	359, 1025, 1117, 1120
MflI	RGATCY	1 cut(s)	838
MlsI	TGGCCA	1 cut(s)	1010
MluCI	AATT	3 cut(s)	22, 289, 1021
MluNI	TGGCCA	1 cut(s)	1010
Mly113I	GGCGCC	1 cut(s)	165
MlyI	GAGTC	4 cut(s)	277, 584, 611, 1107
MmeI	TCCRAC	1 cut(s)	680
Mox20I	TGGCCA	1 cut(s)	1010
MroXI	GAANNNNTTC	1 cut(s)	1032
MscI	TGGCCA	1 cut(s)	1010
MseI	TTAA	4 cut(s)	66, 333, 833, 885
MslI	CAYNNNNRTG	1 cut(s)	87
Msp20I	TGGCCA	1 cut(s)	1010
MspI	CCGG	1 cut(s)	311
MwoI	GCNNNNNNNGC	1 cut(s)	765
NarI	GGCGCC	1 cut(s)	165
NdeI	CATATG	1 cut(s)	433
NdeII	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
NlaIII	CATG	9 cut(s)	152, 164, 208, 302, 959, 1001, 1017, 1086, 1120
NlaIV	GGNNCC	2 cut(s)	166, 210
NmuCI	GTSAC	2 cut(s)	70, 788
NspI	RCATGY	1 cut(s)	1086
NspV	TTCGAA	1 cut(s)	242
PagI	TCATGA	1 cut(s)	298
PciI	ACATGT	1 cut(s)	1082
PcsI	WCGNNNNNNNCGW	1 cut(s)	342
PdmI	GAANNNNTTC	1 cut(s)	1032
PfeI	GAWTC	2 cut(s)	304, 478
PflFI	GACNNNGTC	1 cut(s)	706
PflMI	CCANNNNNTGG	1 cut(s)	1017
PkrI	GCNGC	3 cut(s)	507, 761, 961
PleI	GAGTC	4 cut(s)	277, 584, 610, 1107
PluTI	GGCGCC	1 cut(s)	168
PpsI	GAGTC	4 cut(s)	277, 584, 610, 1107
PpuMI	RGGWCCY	1 cut(s)	920
PscI	ACATGT	1 cut(s)	1082
PshAI	GACNNNNGTC	1 cut(s)	1117
Psp5II	RGGWCCY	1 cut(s)	920
PspFI	CCCAGC	2 cut(s)	211, 728
PspN4I	GGNNCC	2 cut(s)	166, 210
PspPI	GGNCC	4 cut(s)	208, 231, 628, 920
PspPPI	RGGWCCY	1 cut(s)	920
PsuI	RGATCY	1 cut(s)	838
PsyI	GACNNNGTC	1 cut(s)	706
RsaI	GTAC	3 cut(s)	258, 382, 401
RsaNI	GTAC	3 cut(s)	257, 381, 400
RseI	CAYNNNNRTG	1 cut(s)	87
SaqAI	TTAA	4 cut(s)	66, 333, 833, 885
SatI	GCNGC	3 cut(s)	506, 760, 960
Sau3AI	GATC	9 cut(s)	57, 77, 273, 647, 687, 827, 838, 867, 873
Sau96I	GGNCC	4 cut(s)	208, 231, 628, 920
SchI	GAGTC	4 cut(s)	277, 584, 611, 1107
SfcI	CTRYAG	1 cut(s)	462
SfoI	GGCGCC	1 cut(s)	166
SfuI	TTCGAA	1 cut(s)	242
SinI	GGWCC	1 cut(s)	920
SmiMI	CAYNNNNRTG	1 cut(s)	87
SmlI	CTYRAG	1 cut(s)	376
SmoI	CTYRAG	1 cut(s)	376
Sse9I	AATT	3 cut(s)	22, 289, 1021
SsiI	CCGC	3 cut(s)	506, 619, 626
SspDI	GGCGCC	1 cut(s)	164
SspI	AATATT	1 cut(s)	894
SspMI	CTAG	3 cut(s)	216, 723, 1092
StyI	CCWWGG	3 cut(s)	769, 850, 863
TaiI	ACGT	2 cut(s)	120, 136
TaqI	TCGA	4 cut(s)	242, 637, 710, 812
TasI	AATT	3 cut(s)	22, 289, 1021
TatI	WGTACW	2 cut(s)	380, 399
TauI	GCSGC	1 cut(s)	508
TfiI	GAWTC	2 cut(s)	304, 478
Tru1I	TTAA	4 cut(s)	66, 333, 833, 885
Tru9I	TTAA	4 cut(s)	66, 333, 833, 885
TscAI	CASTG	1 cut(s)	519
TseFI	GTSAC	2 cut(s)	70, 788
TseI	GCWGC	2 cut(s)	759, 959
Tsp45I	GTSAC	2 cut(s)	70, 788
TspDTI	ATGAA	4 cut(s)	165, 903, 944, 986
TspRI	CASTG	1 cut(s)	519
Tth111I	GACNNNGTC	1 cut(s)	706
Van91I	CCANNNNNTGG	1 cut(s)	1017
VpaK11BI	GGWCC	1 cut(s)	920
XagI	CCTNNNNNAGG	2 cut(s)	126, 773
XapI	RAATTY	2 cut(s)	289, 1021
XceI	RCATGY	1 cut(s)	1086
XmnI	GAANNNNTTC	1 cut(s)	1032
XspI	CTAG	3 cut(s)	216, 723, 1092
ZraI	GACGTC	1 cut(s)	118

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.