RchiOBHm_Chr5g0007901

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0003281
Physical Location & Seq
Forward (+)
5038096 .. 5038840
745 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28892

Sequence Viewer

Length: 177 bp
ATGAATTCAATCAAGAAGAAGCGAAAGAAGAAACTCCAGCTGGTTTCCTTTTGGCAGACGTCTGTAGGATACGTTTTGATTGATTCAGCTTTGATTGTGTCTCGAAGAGAAGACGCGAAGAGTGCGGCTGTTTTGTCTCAATCAGATACGACCGTATCCGTGGCGTATCAAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.49

Weight (kDa)

10.09

Isoelectric Point (pI)

41.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 62
AccII CGCG 1 cut(s) 116
AciI CCGC 1 cut(s) 125
AcsI RAATTY 1 cut(s) 4
AcyI GRCGYC 1 cut(s) 59
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 2 cut(s) 40, 89
AluI AGCT 2 cut(s) 40, 89
Alw26I GTCTC 2 cut(s) 105, 141
ApoI RAATTY 1 cut(s) 4
BaeI ACNNNNGTAYC 4 cut(s) 138, 138, 171, 171
BbsI GAAGAC 1 cut(s) 117
BciVI GTATCC 2 cut(s) 62, 166
BcoDI GTCTC 2 cut(s) 105, 141
BfmI CTRYAG 1 cut(s) 63
BfuI GTATCC 2 cut(s) 62, 166
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 117
BpmI CTGGAG 1 cut(s) 20
BsaHI GRCGYC 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 159
Bsh1236I CGCG 1 cut(s) 116
Bsh1285I CGRYCG 1 cut(s) 153
BsiEI CGRYCG 1 cut(s) 153
BsmAI GTCTC 2 cut(s) 105, 141
BspACI CCGC 1 cut(s) 125
BspFNI CGCG 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 159
BssNI GRCGYC 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 2 cut(s) 100, 113
BstACI GRCGYC 1 cut(s) 59
BstDSI CCRYGG 1 cut(s) 159
BstFNI CGCG 1 cut(s) 116
BstMAI GTCTC 2 cut(s) 105, 141
BstMCI CGRYCG 1 cut(s) 153
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 63
BstUI CGCG 1 cut(s) 116
BstV2I GAAGAC 1 cut(s) 117
BsuI GTATCC 2 cut(s) 62, 166
BtgI CCRYGG 1 cut(s) 159
CseI GACGC 1 cut(s) 122
CviJI RGCY 3 cut(s) 40, 89, 128
CviKI_1 RGCY 3 cut(s) 40, 89, 128
Eam1104I CTCTTC 2 cut(s) 100, 113
EarI CTCTTC 2 cut(s) 100, 113
EcoRI GAATTC 1 cut(s) 4
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
FspEI CC 9 cut(s) 26, 37, 50, 51, 61, 110, 146, 166, 172
GluI GCNGC 1 cut(s) 126
GsuI CTGGAG 1 cut(s) 20
HgaI GACGC 1 cut(s) 122
Hin1I GRCGYC 1 cut(s) 59
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 13, 102
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4IV ACGT 2 cut(s) 59, 72
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpySE526I ACGT 2 cut(s) 59, 72
Hsp92I GRCGYC 1 cut(s) 59
LpnPI CCDG 2 cut(s) 26, 50
MaeII ACGT 2 cut(s) 59, 72
MboII GAAGA 5 cut(s) 28, 40, 117, 122, 130
MluCI AATT 2 cut(s) 4, 172
MspA1I CMGCKG 1 cut(s) 40
MvnI CGCG 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 122
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 1 cut(s) 127
PvuII CAGCTG 1 cut(s) 40
SatI GCNGC 1 cut(s) 126
SetI ASST 4 cut(s) 42, 62, 75, 91
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 6 cut(s) 25, 49, 53, 114, 127, 172
Sse9I AATT 2 cut(s) 4, 172
SsiI CCGC 1 cut(s) 125
TaaI ACNGT 1 cut(s) 154
TaiI ACGT 2 cut(s) 62, 75
TaqI TCGA 1 cut(s) 103
TasI AATT 2 cut(s) 4, 172
TauI GCSGC 1 cut(s) 128
TfiI GAWTC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 148
XapI RAATTY 1 cut(s) 4
ZraI GACGTC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.