Rmu_sc0015943.1_g000001

Belongs to the GDA1 CD39 NTPase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015943.1
OG0003281
Physical Location & Seq
Forward (+)
11972 .. 15271
3300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015943.1_g000001.1.cds

Sequence Viewer

Length: 963 bp
atggatattgtttgtttgaatttcaagggggtcaagcaaccaaggcatcagacatcctacgcaacacagacagcctacacaacacacagtaacggaccaaaaatttttgggcttgttcccaaggcttctttgtttgagttggaggcagctggtctacaatactgtgaagacgaatgggacaaacagaaaaatcaacataatattgttgatgattcagatctgctgaaatattgtttctcatctgcttatatggtggcactgttgcatgacagtctaggaatccccatggatgagaaaagggttggatttgcaaaccagactggaaatattctccatgattggactctcggtgctttcattgttgaaacaatgctggaaccccttgaatgggaacttgataataatctgggccagattgttggaaatgagtctgtcacgtatttctctgtctttgcatttcttttaatagctgtgtttgctgtattctttgtattgcaatcgcggaaaccacagttaaagactatatacgatttagaaaaaggacgctatattattacacgtgtacgcagcattgcctgcgctactactacccctgcagcccctgcgtcgcaagtcaacgctaaccctaccaggttagcctcgctgcccctgcaagccctgcttgccttctgccctcgcacgcactcgcctaccttctcgaccgcgactcaccagcaacaccgcgaccctgcaacacagtgtcaccacaactcgctcgcgacccagcgacctcgcggcatcgcgacattcctgcagcatcctcgcggcatccctgcagcatcttcgcggcatccctgcagcaccctcacggcatccctgcgacaccgaacccactcccgcgatactccagtgacgcacttgcaaactcttctgcgacaagcctgcgaccccgcgaaacccgtgaccccgcgaccatctctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00240 ko05169 map00230 map00240 map05169
Pfam Domains
Protein Families
GDA1_CD39

Protein Analysis

320

Amino Acids

35.66

Weight (kDa)

8.76

Isoelectric Point (pI)

40.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 154
AciI CCGC 9 cut(s) 502, 702, 721, 774, 804, 826, 877, 930, 947
AcsI RAATTY 2 cut(s) 19, 102
AcvI CACGTG 1 cut(s) 560
AfaI GTAC 1 cut(s) 564
AfiI CCNNNNNNNGG 2 cut(s) 387, 388
AflIII ACRYGT 2 cut(s) 557, 559
AgsI TTSAA 4 cut(s) 19, 25, 365, 386
AjnI CCWGG 1 cut(s) 629
AluBI AGCT 2 cut(s) 149, 470
AluI AGCT 2 cut(s) 149, 470
AlwNI CAGNNNCTG 1 cut(s) 602
AoxI GGCC 1 cut(s) 409
ApeKI GCWGC 7 cut(s) 146, 567, 596, 643, 793, 815, 837
ApoI RAATTY 2 cut(s) 19, 102
AspLEI GCGC 1 cut(s) 581
AspS9I GGNCC 2 cut(s) 95, 409
AsuHPI GGTGA 2 cut(s) 701, 734
AvaII GGWCC 1 cut(s) 95
BaeI ACNNNNGTAYC 2 cut(s) 873, 906
BbrPI CACGTG 1 cut(s) 560
BbsI GAAGAC 1 cut(s) 174
BbvI GCAGC 7 cut(s) 158, 579, 608, 630, 805, 827, 849
BccI CCATC 1 cut(s) 961
BceAI ACGGC 1 cut(s) 864
BcgI CGANNNNNNTGC 8 cut(s) 772, 782, 804, 806, 816, 838, 903, 937
BciT130I CCWGG 1 cut(s) 631
BfaI CTAG 2 cut(s) 275, 961
BfmI CTRYAG 4 cut(s) 594, 791, 813, 835
BglII AGATCT 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 631
Bme18I GGWCC 1 cut(s) 95
BmgT120I GGNCC 2 cut(s) 95, 409
BmiI GGNNCC 1 cut(s) 378
BmrFI CCNGG 1 cut(s) 631
BmsI GCATC 7 cut(s) 55, 786, 805, 816, 827, 838, 860
BpiI GAAGAC 1 cut(s) 174
BpmI CTGGAG 1 cut(s) 870
BsaAI YACGTR 2 cut(s) 438, 560
BsaBI GATNNNNATC 2 cut(s) 216, 402
BsaJI CCNNGG 3 cut(s) 41, 120, 285
Bsc4I CCNNNNNNNGG 2 cut(s) 387, 388
Bse1I ACTGG 2 cut(s) 325, 887
Bse3DI GCAATG 1 cut(s) 570
Bse8I GATNNNNATC 2 cut(s) 216, 402
BseBI CCWGG 1 cut(s) 631
BseDI CCNNGG 3 cut(s) 41, 120, 285
BseGI GGATG 6 cut(s) 53, 295, 796, 807, 829, 851
BseJI GATNNNNATC 2 cut(s) 216, 402
BseLI CCNNNNNNNGG 2 cut(s) 387, 388
BseMI GCAATG 1 cut(s) 570
BseNI ACTGG 2 cut(s) 325, 887
BseXI GCAGC 7 cut(s) 158, 579, 608, 630, 805, 827, 849
BseYI CCCAGC 1 cut(s) 762
Bsh1285I CGRYCG 1 cut(s) 702
BshFI GGCC 1 cut(s) 411
BsiEI CGRYCG 1 cut(s) 702
BslFI GGGAC 1 cut(s) 191
BslI CCNNNNNNNGG 2 cut(s) 387, 388
BsmFI GGGAC 1 cut(s) 191
BsnI GGCC 1 cut(s) 411
Bsp143I GATC 1 cut(s) 217
Bsp19I CCATGG 1 cut(s) 285
Bsp68I TCGCGA 2 cut(s) 758, 782
BspACI CCGC 9 cut(s) 502, 702, 721, 774, 804, 826, 877, 930, 947
BspANI GGCC 1 cut(s) 411
BspLI GGNNCC 1 cut(s) 378
BspMAI CTGCAG 4 cut(s) 598, 795, 817, 839
BsrDI GCAATG 1 cut(s) 570
BsrI ACTGG 2 cut(s) 325, 887
BssECI CCNNGG 3 cut(s) 41, 120, 285
BssMI GATC 1 cut(s) 217
BssT1I CCWWGG 3 cut(s) 41, 120, 285
Bst2UI CCWGG 1 cut(s) 631
Bst4CI ACNGT 6 cut(s) 89, 164, 261, 272, 513, 738
Bst6I CTCTTC 1 cut(s) 912
BstAPI GCANNNNNTGC 3 cut(s) 576, 602, 658
BstBAI YACGTR 2 cut(s) 438, 560
BstC8I GCNNGC 6 cut(s) 577, 654, 663, 680, 756, 922
BstDSI CCRYGG 1 cut(s) 285
BstF5I GGATG 6 cut(s) 53, 295, 796, 807, 829, 851
BstHHI GCGC 1 cut(s) 581
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstMCI CGRYCG 1 cut(s) 702
BstMWI GCNNNNNNNGC 7 cut(s) 43, 476, 576, 602, 649, 658, 662
BstNI CCWGG 1 cut(s) 631
BstSCI CCNGG 1 cut(s) 629
BstSFI CTRYAG 4 cut(s) 594, 791, 813, 835
BstV1I GCAGC 7 cut(s) 158, 579, 608, 630, 805, 827, 849
BstV2I GAAGAC 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 217
BstXI CCANNNNNNTGG 1 cut(s) 419
BstYI RGATCY 1 cut(s) 217
BsuRI GGCC 1 cut(s) 411
BtgI CCRYGG 1 cut(s) 285
BtgZI GCGATG 1 cut(s) 763
BtsCI GGATG 6 cut(s) 53, 295, 796, 807, 829, 851
BtsIMutI CAGTG 3 cut(s) 257, 743, 894
BtuMI TCGCGA 2 cut(s) 758, 782
Cac8I GCNNGC 6 cut(s) 577, 654, 663, 680, 756, 922
CaiI CAGNNNCTG 1 cut(s) 602
CfoI GCGC 1 cut(s) 581
Cfr13I GGNCC 2 cut(s) 95, 409
CseI GACGC 3 cut(s) 552, 594, 901
CsiI ACCWGGT 1 cut(s) 629
Csp6I GTAC 1 cut(s) 563
CviAII CATG 3 cut(s) 266, 286, 335
CviQI GTAC 1 cut(s) 563
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 912
EarI CTCTTC 1 cut(s) 912
Eco130I CCWWGG 3 cut(s) 41, 120, 285
Eco47I GGWCC 1 cut(s) 95
Eco72I CACGTG 1 cut(s) 560
EcoRII CCWGG 1 cut(s) 629
EcoT14I CCWWGG 3 cut(s) 41, 120, 285
ErhI CCWWGG 3 cut(s) 41, 120, 285
FaeI CATG 3 cut(s) 269, 289, 338
FaiI YATR 9 cut(s) 198, 249, 251, 267, 287, 336, 524, 526, 549
FalI AAGNNNNNCTT 2 cut(s) 645, 677
FaqI GGGAC 1 cut(s) 191
FatI CATG 3 cut(s) 265, 285, 334
FauI CCCGC 3 cut(s) 884, 937, 954
FblI GTMKAC 1 cut(s) 154
FokI GGATG 6 cut(s) 40, 302, 783, 794, 816, 838
FspBI CTAG 2 cut(s) 275, 961
GlaI GCGC 1 cut(s) 580
GsaI CCCAGC 1 cut(s) 766
GsuI CTGGAG 1 cut(s) 870
HaeIII GGCC 1 cut(s) 411
HgaI GACGC 3 cut(s) 552, 594, 901
HhaI GCGC 1 cut(s) 581
Hin1II CATG 3 cut(s) 269, 289, 338
Hin6I GCGC 1 cut(s) 579
HinP1I GCGC 1 cut(s) 579
HincII GTYRAC 1 cut(s) 616
HindII GTYRAC 1 cut(s) 616
HinfI GANTC 5 cut(s) 212, 279, 343, 428, 706
HphI GGTGA 2 cut(s) 701, 734
Hpy166II GTNNAC 3 cut(s) 155, 563, 616
Hpy188I TCNGA 2 cut(s) 51, 217
Hpy188III TCNNGA 3 cut(s) 697, 757, 781
Hpy8I GTNNAC 3 cut(s) 155, 563, 616
Hpy99I CGWCG 1 cut(s) 610
HpyAV CCTTC 2 cut(s) 676, 703
HpyCH4III ACNGT 6 cut(s) 89, 164, 261, 272, 513, 738
HpyCH4IV ACGT 2 cut(s) 437, 559
HpyF10VI GCNNNNNNNGC 7 cut(s) 43, 476, 576, 602, 649, 658, 662
HpySE526I ACGT 2 cut(s) 437, 559
Hsp92II CATG 3 cut(s) 269, 289, 338
HspAI GCGC 1 cut(s) 579
Kzo9I GATC 1 cut(s) 217
Lsp1109I GCAGC 7 cut(s) 158, 579, 608, 630, 805, 827, 849
LweI GCATC 7 cut(s) 55, 786, 805, 816, 827, 838, 860
MabI ACCWGGT 1 cut(s) 629
MaeI CTAG 2 cut(s) 275, 961
MaeII ACGT 2 cut(s) 437, 559
MaeIII GTNAC 5 cut(s) 89, 433, 740, 889, 940
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 3 cut(s) 179, 813, 899
MflI RGATCY 1 cut(s) 217
MluCI AATT 2 cut(s) 19, 102
MlyI GAGTC 3 cut(s) 337, 437, 700
MmeI TCCRAC 3 cut(s) 120, 283, 400
MnlI CCTC 6 cut(s) 136, 649, 684, 780, 810, 854
MseI TTAA 2 cut(s) 464, 515
MspA1I CMGCKG 1 cut(s) 149
MspR9I CCNGG 1 cut(s) 631
MvaI CCWGG 1 cut(s) 631
MwoI GCNNNNNNNGC 7 cut(s) 43, 476, 576, 602, 649, 658, 662
NcoI CCATGG 1 cut(s) 285
NdeII GATC 1 cut(s) 217
NlaIII CATG 3 cut(s) 269, 289, 338
NlaIV GGNNCC 1 cut(s) 378
NmuCI GTSAC 4 cut(s) 433, 740, 889, 940
NruI TCGCGA 2 cut(s) 758, 782
PfeI GAWTC 2 cut(s) 212, 279
PleI GAGTC 3 cut(s) 337, 436, 700
PmaCI CACGTG 1 cut(s) 560
PmlI CACGTG 1 cut(s) 560
PpsI GAGTC 3 cut(s) 337, 436, 700
Ppu21I YACGTR 2 cut(s) 438, 560
Psp6I CCWGG 1 cut(s) 629
PspCI CACGTG 1 cut(s) 560
PspFI CCCAGC 1 cut(s) 762
PspGI CCWGG 1 cut(s) 629
PspN4I GGNNCC 1 cut(s) 378
PspPI GGNCC 2 cut(s) 95, 409
PstI CTGCAG 4 cut(s) 598, 795, 817, 839
PstNI CAGNNNCTG 1 cut(s) 602
PsuI RGATCY 1 cut(s) 217
PvuII CAGCTG 1 cut(s) 149
RruI TCGCGA 2 cut(s) 758, 782
RsaI GTAC 1 cut(s) 564
RsaNI GTAC 1 cut(s) 563
SaqAI TTAA 2 cut(s) 464, 515
Sau3AI GATC 1 cut(s) 217
Sau96I GGNCC 2 cut(s) 95, 409
SchI GAGTC 3 cut(s) 337, 437, 700
ScrFI CCNGG 1 cut(s) 631
SetI ASST 7 cut(s) 151, 440, 472, 562, 635, 695, 772
SexAI ACCWGGT 1 cut(s) 629
SfaNI GCATC 7 cut(s) 55, 786, 805, 816, 827, 838, 860
SfcI CTRYAG 4 cut(s) 594, 791, 813, 835
SinI GGWCC 1 cut(s) 95
Sse9I AATT 2 cut(s) 19, 102
SsiI CCGC 9 cut(s) 502, 702, 721, 774, 804, 826, 877, 930, 947
SspI AATATT 3 cut(s) 202, 230, 328
SspMI CTAG 2 cut(s) 275, 961
StyD4I CCNGG 1 cut(s) 629
StyI CCWWGG 3 cut(s) 41, 120, 285
TaaI ACNGT 6 cut(s) 89, 164, 261, 272, 513, 738
TaiI ACGT 2 cut(s) 440, 562
TaqI TCGA 1 cut(s) 698
TasI AATT 2 cut(s) 19, 102
TauI GCSGC 3 cut(s) 777, 807, 829
TfiI GAWTC 2 cut(s) 212, 279
Tru1I TTAA 2 cut(s) 464, 515
Tru9I TTAA 2 cut(s) 464, 515
TscAI CASTG 3 cut(s) 264, 743, 894
TseFI GTSAC 4 cut(s) 433, 740, 889, 940
TseI GCWGC 7 cut(s) 146, 567, 596, 643, 793, 815, 837
Tsp45I GTSAC 4 cut(s) 433, 740, 889, 940
TspDTI ATGAA 1 cut(s) 346
TspGWI ACGGA 1 cut(s) 108
TspRI CASTG 3 cut(s) 264, 743, 894
VpaK11BI GGWCC 1 cut(s) 95
XapI RAATTY 2 cut(s) 19, 102
XmiI GTMKAC 1 cut(s) 154
XspI CTAG 2 cut(s) 275, 961
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.