RchiOBHm_Chr4g0422221

Heat shock factor-binding protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
47917980 .. 47919256
1277 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGTTAATAGAATTGCCATGGGATTGGTGGTGCTTGCCATGTCTAGACTTACTTTTAGATTTGCTCTTTCAGTTGGTATGGGCAACAGGATCGAGGAGTTAGAGCAGAGCATCAATGATCTCAGAGCCGAAATGGGAGTGGAGGGCACACCATCCCCTTCAGCCCCTTCAAAGCCCAAGGTAGATACGAAGTCAGCTGATGATTCAGCCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.62

Weight (kDa)

6.16

Isoelectric Point (pI)

51.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AcuI CTGAAG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 171
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
AlwI GGATC 1 cut(s) 98
BaeGI GKGCMC 1 cut(s) 149
BccI CCATC 1 cut(s) 160
BcgI CGANNNNNNTGC 2 cut(s) 73, 107
BfaI CTAG 1 cut(s) 45
BmsI GCATC 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 18, 177
BseDI CCNNGG 2 cut(s) 18, 177
BseGI GGATG 1 cut(s) 152
BseMII CTCAG 1 cut(s) 136
BseRI GAGGAG 1 cut(s) 110
BseSI GKGCMC 1 cut(s) 149
Bsp1286I GDGCHC 1 cut(s) 149
Bsp143I GATC 2 cut(s) 90, 118
Bsp19I CCATGG 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 135
BspPI GGATC 1 cut(s) 98
BssECI CCNNGG 2 cut(s) 18, 177
BssMI GATC 2 cut(s) 90, 118
BssT1I CCWWGG 2 cut(s) 18, 177
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 122
BstDSI CCRYGG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 152
BstKTI GATC 2 cut(s) 93, 121
BstMBI GATC 2 cut(s) 90, 118
BstSLI GKGCMC 1 cut(s) 149
BstXI CCANNNNNNTGG 1 cut(s) 25
BtgI CCRYGG 1 cut(s) 18
BtsCI GGATG 1 cut(s) 152
Cac8I GCNNGC 1 cut(s) 36
CviAII CATG 2 cut(s) 19, 40
CviJI RGCY 5 cut(s) 128, 164, 175, 197, 209
CviKI_1 RGCY 5 cut(s) 128, 164, 175, 197, 209
DdeI CTNAG 1 cut(s) 122
DpnI GATC 2 cut(s) 92, 120
DpnII GATC 2 cut(s) 90, 118
Eco130I CCWWGG 2 cut(s) 18, 177
Eco57I CTGAAG 1 cut(s) 144
EcoT14I CCWWGG 2 cut(s) 18, 177
ErhI CCWWGG 2 cut(s) 18, 177
FaeI CATG 2 cut(s) 22, 43
FaiI YATR 3 cut(s) 20, 41, 80
FatI CATG 2 cut(s) 18, 39
FokI GGATG 1 cut(s) 139
FspBI CTAG 1 cut(s) 45
Hin1II CATG 2 cut(s) 22, 43
HinfI GANTC 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 45
HpyAV CCTTC 2 cut(s) 168, 177
HpyF3I CTNAG 1 cut(s) 122
Hsp92II CATG 2 cut(s) 22, 43
Kzo9I GATC 2 cut(s) 90, 118
LpnPI CCDG 1 cut(s) 73
LweI GCATC 1 cut(s) 120
MaeI CTAG 1 cut(s) 45
MalI GATC 2 cut(s) 92, 120
MboI GATC 2 cut(s) 90, 118
MhlI GDGCHC 1 cut(s) 149
MluCI AATT 1 cut(s) 12
MnlI CCTC 2 cut(s) 88, 136
MseI TTAA 1 cut(s) 6
MspA1I CMGCKG 1 cut(s) 197
NcoI CCATGG 1 cut(s) 18
NdeII GATC 2 cut(s) 90, 118
NlaIII CATG 2 cut(s) 22, 43
PfeI GAWTC 1 cut(s) 203
PvuII CAGCTG 1 cut(s) 197
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 2 cut(s) 90, 118
SduI GDGCHC 1 cut(s) 149
SetI ASST 2 cut(s) 183, 199
SfaNI GCATC 1 cut(s) 120
SgeI CNNG 7 cut(s) 31, 47, 52, 57, 100, 106, 190
Sse9I AATT 1 cut(s) 12
SspMI CTAG 1 cut(s) 45
StyI CCWWGG 2 cut(s) 18, 177
TaqI TCGA 1 cut(s) 93
TasI AATT 1 cut(s) 12
TfiI GAWTC 1 cut(s) 203
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
XbaI TCTAGA 1 cut(s) 44
XcmI CCANNNNNNNNNTGG 1 cut(s) 25
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.