RchiOBHm_Chr4g0422231

Heat shock factor binding protein 1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
47919258 .. 47921697
2440 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGGATGGACATGATACAGATGACCTGAAACAAAGCACTGCTGATATGACAGCTTTTGTACAAAATCTTCTCCAGCAGATGCAAACCAGGTTCCAGACAATGTCTGACTCCATCGTCTCGAAGAATATCCTTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.09

Weight (kDa)

4.38

Isoelectric Point (pI)

53.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSBP1 PF06825 15 - 41 1.7e-12 Heat shock factor binding protein 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 113
AfaI GTAC 1 cut(s) 60
AjnI CCWGG 1 cut(s) 86
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Alw26I GTCTC 1 cut(s) 121
BarI GAAGNNNNNNTAC 2 cut(s) 51, 83
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 88
BcoDI GTCTC 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 88
BmsI GCATC 1 cut(s) 69
BpmI CTGGAG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 88
BseGI GGATG 1 cut(s) 10
BsmAI GTCTC 1 cut(s) 121
BsmBI CGTCTC 1 cut(s) 121
Bsp1407I TGTACA 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 92
BsrGI TGTACA 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 88
BstAUI TGTACA 1 cut(s) 58
BstF5I GGATG 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 88
BstSCI CCNGG 1 cut(s) 86
BtsCI GGATG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 36
CsiI ACCWGGT 1 cut(s) 86
Csp6I GTAC 1 cut(s) 59
CviAII CATG 1 cut(s) 11
CviJI RGCY 1 cut(s) 53
CviKI_1 RGCY 1 cut(s) 53
CviQI GTAC 1 cut(s) 59
DrdI GACNNNNNNGTC 1 cut(s) 113
DseDI GACNNNNNNGTC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 86
Esp3I CGTCTC 1 cut(s) 121
FaeI CATG 1 cut(s) 14
FaiI YATR 3 cut(s) 12, 47, 136
FatI CATG 1 cut(s) 10
FokI GGATG 1 cut(s) 17
FspEI CC 6 cut(s) 38, 73, 86, 100, 107, 124
GsuI CTGGAG 1 cut(s) 56
Hin1II CATG 1 cut(s) 14
HinfI GANTC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 2 cut(s) 94, 118
HpyCH4V TGCA 1 cut(s) 82
Hsp92II CATG 1 cut(s) 14
LpnPI CCDG 5 cut(s) 38, 73, 86, 100, 107
LweI GCATC 1 cut(s) 69
MabI ACCWGGT 1 cut(s) 86
MboII GAAGA 2 cut(s) 59, 133
MlyI GAGTC 1 cut(s) 101
MspR9I CCNGG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 88
NlaIII CATG 1 cut(s) 14
NlaIV GGNNCC 1 cut(s) 92
PflFI GACNNNGTC 1 cut(s) 100
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 86
PspGI CCWGG 1 cut(s) 86
PspN4I GGNNCC 1 cut(s) 92
PsyI GACNNNGTC 1 cut(s) 100
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SchI GAGTC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 88
SetI ASST 3 cut(s) 27, 55, 92
SexAI ACCWGGT 1 cut(s) 86
SfaNI GCATC 1 cut(s) 69
SgeI CNNG 7 cut(s) 23, 37, 85, 99, 100, 106, 130
StyD4I CCNGG 1 cut(s) 86
TaqI TCGA 1 cut(s) 119
TatI WGTACW 1 cut(s) 58
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 123
TspRI CASTG 1 cut(s) 43
Tth111I GACNNNGTC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.