RchiOBHm_Chr2g0148771

dual specificity protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
66533515 .. 66540402
6888 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGTCATCAGGAATAAGCTTCAAGCTAAGTGGTGAGGTGCCTCACTTAAAGGAGGTCGGAGTTCGTGGAGTCATCACACTTAATGAGCCATATGAGACTGATTCCAACATCTCTTTATCAGTCTGCAATGGTACCCTGAAGGAAAACAGGAGAGAAAGAGCCCACAGCACAGAAAGCTTTGTCTTGGTGAGCTTAACAAACCACCACTTCCAGTTTGTGCTATCTCTACAGCTTTAA

Protein Analysis

78

Amino Acids

8.69

Weight (kDa)

6.39

Isoelectric Point (pI)

28.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 131
AccB1I GGYRCC 2 cut(s) 37, 131
AcuI CTGAAG 1 cut(s) 158
AfaI GTAC 1 cut(s) 133
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 5 cut(s) 18, 25, 177, 192, 232
AluI AGCT 5 cut(s) 18, 25, 177, 192, 232
Alw26I GTCTC 1 cut(s) 89
Asp718I GGTACC 1 cut(s) 131
AsuHPI GGTGA 2 cut(s) 44, 199
BanI GGYRCC 2 cut(s) 37, 131
BanII GRGCYC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 89
BfmI CTRYAG 1 cut(s) 227
BmiI GGNNCC 2 cut(s) 39, 133
Bse1I ACTGG 1 cut(s) 211
Bse3DI GCAATG 1 cut(s) 133
BseMI GCAATG 1 cut(s) 133
BseNI ACTGG 1 cut(s) 211
BshNI GGYRCC 2 cut(s) 37, 131
BsmAI GTCTC 1 cut(s) 89
Bsp1286I GDGCHC 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 39, 133
BspT107I GGYRCC 2 cut(s) 37, 131
BsrDI GCAATG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 26
BstMAI GTCTC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstSFI CTRYAG 1 cut(s) 227
Csp6I GTAC 1 cut(s) 132
CspCI CAANNNNNGTGG 2 cut(s) 10, 45
CviJI RGCY 7 cut(s) 18, 25, 88, 161, 177, 192, 232
CviKI_1 RGCY 7 cut(s) 18, 25, 88, 161, 177, 192, 232
CviQI GTAC 1 cut(s) 132
DdeI CTNAG 1 cut(s) 26
Eco24I GRGCYC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 158
EcoT38I GRGCYC 1 cut(s) 163
FaiI YATR 2 cut(s) 91, 93
FauNDI CATATG 1 cut(s) 91
FriOI GRGCYC 1 cut(s) 163
HindIII AAGCTT 2 cut(s) 16, 175
HinfI GANTC 2 cut(s) 69, 101
HphI GGTGA 2 cut(s) 44, 199
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 1 cut(s) 9
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 26
KpnI GGTACC 1 cut(s) 135
LpnPI CCDG 3 cut(s) 133, 149, 224
MhlI GDGCHC 1 cut(s) 163
MlyI GAGTC 1 cut(s) 78
MmeI TCCRAC 2 cut(s) 37, 129
MnlI CCTC 3 cut(s) 28, 46, 51
MseI TTAA 4 cut(s) 47, 81, 194, 235
MwoI GCNNNNNNNGC 1 cut(s) 174
NdeI CATATG 1 cut(s) 91
NlaIV GGNNCC 2 cut(s) 39, 133
PfeI GAWTC 1 cut(s) 101
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
PspN4I GGNNCC 2 cut(s) 39, 133
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 4 cut(s) 47, 81, 194, 235
SchI GAGTC 1 cut(s) 78
SduI GDGCHC 1 cut(s) 163
SetI ASST 7 cut(s) 20, 27, 39, 57, 179, 194, 234
SfcI CTRYAG 1 cut(s) 227
SgeI CNNG 7 cut(s) 21, 34, 77, 148, 160, 196, 223
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 4 cut(s) 47, 81, 194, 235
Tru9I TTAA 4 cut(s) 47, 81, 194, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.