Rh5DG164400

dual specificity protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
17167789 .. 17179385
11597 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG164400.1

Sequence Viewer

Length: 192 bp
ATGAGCCATATGAGACTGGTTCCAACATCTCTTTATCAGTCCAATGGCATTAGCCATCTGGTGATCCCTACCAGAGACTACTGCTTTGCACCATCGCTGGATGATATATGTCGTGCTGTTCAAGTTATGTGCTCGACGAGACTAGCTCTAGGGAATGCGACGAATCCTCTTCCAATTCTTATCAAACCCTAG

Protein Analysis

63

Amino Acids

6.94

Weight (kDa)

8.63

Isoelectric Point (pI)

25.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 58
AgsI TTSAA 1 cut(s) 122
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw21I GWGCWC 1 cut(s) 134
Alw26I GTCTC 3 cut(s) 7, 69, 133
AlwI GGATC 1 cut(s) 58
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AsuHPI GGTGA 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 134
BccI CCATC 2 cut(s) 63, 100
BcoDI GTCTC 3 cut(s) 7, 69, 133
BfaI CTAG 3 cut(s) 143, 149, 190
BmiI GGNNCC 1 cut(s) 21
BplI GAGNNNNNCTC 2 cut(s) 130, 162
Bse1I ACTGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 106
BseNI ACTGG 1 cut(s) 21
BsiHKAI GWGCWC 1 cut(s) 134
BsmAI GTCTC 3 cut(s) 7, 69, 133
BsmI GAATGC 1 cut(s) 160
Bsp1286I GDGCHC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 21
BspPI GGATC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 21
BssMI GATC 1 cut(s) 63
Bst6I CTCTTC 1 cut(s) 174
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 3 cut(s) 7, 69, 133
BstMBI GATC 1 cut(s) 63
BtgZI GCGATG 1 cut(s) 78
BtsCI GGATG 1 cut(s) 106
CviJI RGCY 3 cut(s) 6, 54, 146
CviKI_1 RGCY 3 cut(s) 6, 54, 146
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
FaiI YATR 5 cut(s) 9, 11, 107, 109, 128
FauNDI CATATG 1 cut(s) 9
FokI GGATG 1 cut(s) 113
FspBI CTAG 3 cut(s) 143, 149, 190
HinfI GANTC 1 cut(s) 163
HphI GGTGA 1 cut(s) 73
Hpy99I CGWCG 2 cut(s) 139, 163
HpyCH4V TGCA 1 cut(s) 89
Kzo9I GATC 1 cut(s) 63
LpnPI CCDG 4 cut(s) 2, 44, 83, 85
MaeI CTAG 3 cut(s) 143, 149, 190
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 1 cut(s) 161
MhlI GDGCHC 1 cut(s) 134
MluCI AATT 1 cut(s) 174
MmeI TCCRAC 1 cut(s) 47
MnlI CCTC 1 cut(s) 177
Mva1269I GAATGC 1 cut(s) 160
NdeI CATATG 1 cut(s) 9
NdeII GATC 1 cut(s) 63
NlaIV GGNNCC 1 cut(s) 21
PctI GAATGC 1 cut(s) 160
PfeI GAWTC 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 21
Sau3AI GATC 1 cut(s) 63
SduI GDGCHC 1 cut(s) 134
SetI ASST 1 cut(s) 148
Sse9I AATT 1 cut(s) 174
SspMI CTAG 3 cut(s) 143, 149, 190
TaqI TCGA 1 cut(s) 134
TasI AATT 1 cut(s) 174
TfiI GAWTC 1 cut(s) 163
XspI CTAG 3 cut(s) 143, 149, 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.