RchiOBHm_Chr6g0252891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
8111604 .. 8116138
4535 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22675

Sequence Viewer

Length: 246 bp
ATGAAAGACGATTTTGCCCTTCCATTCTGTTTCTTGCTTCGACACTTGGGGTGCTGCTCAGTGTGTGTTGTTTCTTCCTTCGACACCTGGGTGTCTTTGCTACTTCACTCCACAAAGAGGGGTTTAGGGTTGTCGTATTGGGTTTGTCATCAACAAGGAGAAGGAAGGCGATTATGGGTTATTGGCTCAACCTTGAGGTGGAGGTGCGTTGAGAAAAGCAGGAGAGCTGCAGCTTCTGGCATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.2

Weight (kDa)

9.37

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 117, 198
AjnI CCWGG 1 cut(s) 86
AleI CACNNNNGTG 1 cut(s) 89
AluBI AGCT 2 cut(s) 227, 233
AluI AGCT 2 cut(s) 227, 233
AlwNI CAGNNNCTG 1 cut(s) 236
ApeKI GCWGC 3 cut(s) 54, 227, 230
BbvI GCAGC 3 cut(s) 41, 214, 242
BciT130I CCWGG 1 cut(s) 88
BfmI CTRYAG 1 cut(s) 228
BisI GCNGC 3 cut(s) 55, 228, 231
BlsI GCNGC 3 cut(s) 56, 229, 232
Bme1390I CCNGG 1 cut(s) 88
BmrFI CCNGG 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 214
BsaJI CCNNGG 1 cut(s) 87
Bsc4I CCNNNNNNNGG 2 cut(s) 117, 198
BseBI CCWGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 87
BseLI CCNNNNNNNGG 2 cut(s) 117, 198
BseMII CTCAG 1 cut(s) 72
BseXI GCAGC 3 cut(s) 41, 214, 242
BslI CCNNNNNNNGG 2 cut(s) 117, 198
BspCNI CTCAG 1 cut(s) 71
BspMAI CTGCAG 1 cut(s) 232
BssECI CCNNGG 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 58
BstNI CCWGG 1 cut(s) 88
BstSCI CCNGG 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 228
BstV1I GCAGC 3 cut(s) 41, 214, 242
BtsIMutI CAGTG 1 cut(s) 66
CaiI CAGNNNCTG 1 cut(s) 236
CviJI RGCY 3 cut(s) 186, 227, 233
CviKI_1 RGCY 3 cut(s) 186, 227, 233
DdeI CTNAG 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 86
FaiI YATR 1 cut(s) 175
Fnu4HI GCNGC 3 cut(s) 55, 228, 231
Fsp4HI GCNGC 3 cut(s) 55, 228, 231
GluI GCNGC 3 cut(s) 55, 228, 231
HpyAV CCTTC 4 cut(s) 29, 88, 155, 159
HpyCH4V TGCA 1 cut(s) 230
HpyF3I CTNAG 1 cut(s) 58
LpnPI CCDG 4 cut(s) 73, 100, 205, 222
Lsp1109I GCAGC 3 cut(s) 41, 214, 242
MboII GAAGA 1 cut(s) 66
MnlI CCTC 3 cut(s) 111, 189, 195
MslI CAYNNNNRTG 1 cut(s) 89
MspR9I CCNGG 1 cut(s) 88
MvaI CCWGG 1 cut(s) 88
OliI CACNNNNGTG 1 cut(s) 89
PkrI GCNGC 3 cut(s) 56, 229, 232
Psp6I CCWGG 1 cut(s) 86
PspGI CCWGG 1 cut(s) 86
PstI CTGCAG 1 cut(s) 232
PstNI CAGNNNCTG 1 cut(s) 236
RseI CAYNNNNRTG 1 cut(s) 89
SatI GCNGC 3 cut(s) 55, 228, 231
ScrFI CCNGG 1 cut(s) 88
SetI ASST 6 cut(s) 89, 194, 200, 206, 229, 235
SfcI CTRYAG 1 cut(s) 228
SgeI CNNG 7 cut(s) 46, 58, 99, 100, 167, 205, 232
SmiMI CAYNNNNRTG 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
StyD4I CCNGG 1 cut(s) 86
TaqI TCGA 2 cut(s) 40, 81
TscAI CASTG 1 cut(s) 66
TseI GCWGC 3 cut(s) 54, 227, 230
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.