RchiOBHm_Chr6g0251601

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
6861874 .. 6864896
3023 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22555

Sequence Viewer

Length: 141 bp
ATGCAAAGGAGTATTTCGATTGTTCTTCTGCCATTGTTCCTGTATCTGTTATTTGGTATCGGTTTGGTGTTCTATTCTTATACAGATATTAGGAACTGTGAGCTGTTAAATTTTCCAAGTATTTTGAGTTCAGACTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

46

Amino Acids

5.37

Weight (kDa)

4.56

Isoelectric Point (pI)

38.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 109
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
ApoI RAATTY 1 cut(s) 109
Bse1I ACTGG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 140
BsrI ACTGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 98
CviJI RGCY 1 cut(s) 103
CviKI_1 RGCY 1 cut(s) 103
FaiI YATR 1 cut(s) 81
FspEI CC 8 cut(s) 39, 45, 45, 50, 53, 76, 121, 129
Hpy188I TCNGA 1 cut(s) 133
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 2 cut(s) 53, 121
MboII GAAGA 1 cut(s) 17
MluCI AATT 1 cut(s) 109
MseI TTAA 1 cut(s) 107
PsrI GAACNNNNNNTAC 1 cut(s) 112
SaqAI TTAA 1 cut(s) 107
SetI ASST 1 cut(s) 105
SgeI CNNG 2 cut(s) 52, 129
Sse9I AATT 1 cut(s) 109
TaaI ACNGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 17
TasI AATT 1 cut(s) 109
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
XapI RAATTY 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.