Rh6AG247400

dual specificity protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
43624917 .. 43627009
2093 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG247400.1

Sequence Viewer

Length: 366 bp
ATGAGACTGATTCCAACATCTCTTTATCAGTCCAATGGCATTAGCCATCTGGTGATCCCTACCAGAGACTACTGCTTTGCACCATCGTTGAATGATATATGTTGTGCTGTAAACATCATTAATGGAGAAACAAAGAAAATGTTGGGACAGTGTGATCACAATCAGCATTCTGCTTCAGCAACAACTCATAAGTCAAGAAGATCGAAAAGATGGAGAACAGTGTGTCAACAACAAACGGCTGAAGCTTCGCATATTTTCTGTGGAAATGACGAACAAAATTCTGCTGTAATTGCGAACGAGGATCTATTAGTTGGTACGGCATCACATATTGATAATCCAATTATGGGAGCTGTTGATGTTCACTAA

Protein Analysis

121

Amino Acids

13.32

Weight (kDa)

6.63

Isoelectric Point (pI)

48.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 49, 309
AcsI RAATTY 1 cut(s) 277
AcuI CTGAAG 2 cut(s) 159, 261
AfaI GTAC 1 cut(s) 316
AfiI CCNNNNNNNGG 1 cut(s) 344
AgsI TTSAA 1 cut(s) 91
AluBI AGCT 2 cut(s) 245, 350
AluI AGCT 2 cut(s) 245, 350
Alw26I GTCTC 1 cut(s) 60
AlwI GGATC 2 cut(s) 49, 309
ApoI RAATTY 1 cut(s) 277
ArsI GACNNNNNNTTYG 2 cut(s) 59, 91
AseI ATTAAT 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 64
BccI CCATC 3 cut(s) 54, 91, 204
BceAI ACGGC 2 cut(s) 252, 333
BclI TGATCA 1 cut(s) 154
BcoDI GTCTC 1 cut(s) 60
BmsI GCATC 1 cut(s) 329
BsaBI GATNNNNATC 1 cut(s) 159
Bsc4I CCNNNNNNNGG 1 cut(s) 344
Bse8I GATNNNNATC 1 cut(s) 159
BseJI GATNNNNATC 1 cut(s) 159
BseLI CCNNNNNNNGG 1 cut(s) 344
BslFI GGGAC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 344
BsmAI GTCTC 1 cut(s) 60
BsmFI GGGAC 1 cut(s) 159
BsmI GAATGC 1 cut(s) 166
Bsp143I GATC 4 cut(s) 54, 154, 200, 301
BspPI GGATC 2 cut(s) 49, 309
BssMI GATC 4 cut(s) 54, 154, 200, 301
Bst4CI ACNGT 2 cut(s) 150, 220
BstKTI GATC 4 cut(s) 57, 157, 203, 304
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 4 cut(s) 54, 154, 200, 301
BstMWI GCNNNNNNNGC 1 cut(s) 290
BstX2I RGATCY 1 cut(s) 301
BstYI RGATCY 1 cut(s) 301
BtsIMutI CAGTG 2 cut(s) 155, 225
Csp6I GTAC 1 cut(s) 315
CviJI RGCY 4 cut(s) 45, 239, 245, 350
CviKI_1 RGCY 4 cut(s) 45, 239, 245, 350
CviQI GTAC 1 cut(s) 315
DpnI GATC 4 cut(s) 56, 156, 202, 303
DpnII GATC 4 cut(s) 54, 154, 200, 301
Eco57I CTGAAG 2 cut(s) 159, 261
FaiI YATR 6 cut(s) 98, 100, 189, 252, 327, 344
FaqI GGGAC 1 cut(s) 159
FbaI TGATCA 1 cut(s) 154
HincII GTYRAC 1 cut(s) 227
HindII GTYRAC 1 cut(s) 227
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 1 cut(s) 10
HphI GGTGA 1 cut(s) 64
Hpy166II GTNNAC 3 cut(s) 112, 227, 361
Hpy188III TCNNGA 1 cut(s) 195
Hpy8I GTNNAC 3 cut(s) 112, 227, 361
HpyCH4III ACNGT 2 cut(s) 150, 220
HpyCH4V TGCA 1 cut(s) 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 290
Ksp22I TGATCA 1 cut(s) 154
Kzo9I GATC 4 cut(s) 54, 154, 200, 301
LmnI GCTCC 1 cut(s) 347
LpnPI CCDG 2 cut(s) 35, 76
LweI GCATC 1 cut(s) 329
MalI GATC 4 cut(s) 56, 156, 202, 303
MboI GATC 4 cut(s) 54, 154, 200, 301
MboII GAAGA 1 cut(s) 210
MflI RGATCY 1 cut(s) 301
MluCI AATT 3 cut(s) 277, 288, 339
MmeI TCCRAC 1 cut(s) 38
MnlI CCTC 1 cut(s) 292
MseI TTAA 1 cut(s) 120
Mva1269I GAATGC 1 cut(s) 166
MwoI GCNNNNNNNGC 1 cut(s) 290
NdeII GATC 4 cut(s) 54, 154, 200, 301
PctI GAATGC 1 cut(s) 166
PfeI GAWTC 1 cut(s) 10
PshBI ATTAAT 1 cut(s) 120
PsuI RGATCY 1 cut(s) 301
RsaI GTAC 1 cut(s) 316
RsaNI GTAC 1 cut(s) 315
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 4 cut(s) 54, 154, 200, 301
SetI ASST 2 cut(s) 247, 352
SfaNI GCATC 1 cut(s) 329
SgeI CNNG 4 cut(s) 62, 75, 207, 310
Sse9I AATT 3 cut(s) 277, 288, 339
TaaI ACNGT 2 cut(s) 150, 220
TaqI TCGA 1 cut(s) 203
TasI AATT 3 cut(s) 277, 288, 339
TfiI GAWTC 1 cut(s) 10
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TscAI CASTG 2 cut(s) 155, 225
TspRI CASTG 2 cut(s) 155, 225
VspI ATTAAT 1 cut(s) 120
XapI RAATTY 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.