Rh7BG290500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
27256214 .. 27256833
620 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG290500.1

Sequence Viewer

Length: 270 bp
ATGACATCGAAAATTGTATCAGGAGAAACAAAGAAAATGTTGGGACAGTGTGATCACAATCAGAATTTTGCTTCAGCAACAACTCATAAGTCAAGAAGATCTAAAAGATGGAGAACAGTGTGTCAACAACAAACGGCTGAAGCTTCGCATAGTTTCTGTGGAAATGACGAACAAAATTCTGCTGTAATTGCGAACGAGGATCTATTAGTTGGTACAGCATCACATATTGATAATTCAATTATGGGAGATATGCCATCCAATACTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.74

Weight (kDa)

6.89

Isoelectric Point (pI)

54.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 207
AcsI RAATTY 2 cut(s) 64, 175
AcuI CTGAAG 2 cut(s) 57, 159
AfaI GTAC 1 cut(s) 214
AgsI TTSAA 1 cut(s) 237
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AlwI GGATC 1 cut(s) 207
ApoI RAATTY 2 cut(s) 64, 175
BccI CCATC 2 cut(s) 102, 262
BceAI ACGGC 1 cut(s) 150
BclI TGATCA 1 cut(s) 52
BglII AGATCT 1 cut(s) 98
BmsI GCATC 1 cut(s) 227
BsaBI GATNNNNATC 1 cut(s) 57
Bse8I GATNNNNATC 1 cut(s) 57
BseGI GGATG 1 cut(s) 254
BseJI GATNNNNATC 1 cut(s) 57
BslFI GGGAC 1 cut(s) 57
BsmFI GGGAC 1 cut(s) 57
Bsp143I GATC 3 cut(s) 52, 98, 199
BspPI GGATC 1 cut(s) 207
BssMI GATC 3 cut(s) 52, 98, 199
Bst4CI ACNGT 3 cut(s) 48, 118, 265
BstF5I GGATG 1 cut(s) 254
BstKTI GATC 3 cut(s) 55, 101, 202
BstMBI GATC 3 cut(s) 52, 98, 199
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstX2I RGATCY 2 cut(s) 98, 199
BstYI RGATCY 2 cut(s) 98, 199
BtsCI GGATG 1 cut(s) 254
BtsIMutI CAGTG 2 cut(s) 53, 123
Csp6I GTAC 1 cut(s) 213
CviJI RGCY 2 cut(s) 137, 143
CviKI_1 RGCY 2 cut(s) 137, 143
CviQI GTAC 1 cut(s) 213
DpnI GATC 3 cut(s) 54, 100, 201
DpnII GATC 3 cut(s) 52, 98, 199
Eco57I CTGAAG 2 cut(s) 57, 159
FaiI YATR 6 cut(s) 87, 150, 225, 242, 251, 268
FaqI GGGAC 1 cut(s) 57
FbaI TGATCA 1 cut(s) 52
FokI GGATG 1 cut(s) 241
HincII GTYRAC 1 cut(s) 125
HindII GTYRAC 1 cut(s) 125
HindIII AAGCTT 1 cut(s) 141
Hpy166II GTNNAC 1 cut(s) 125
Hpy188I TCNGA 1 cut(s) 63
Hpy188III TCNNGA 2 cut(s) 21, 93
Hpy8I GTNNAC 1 cut(s) 125
HpyCH4III ACNGT 3 cut(s) 48, 118, 265
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
Ksp22I TGATCA 1 cut(s) 52
Kzo9I GATC 3 cut(s) 52, 98, 199
LpnPI CCDG 1 cut(s) 6
LweI GCATC 1 cut(s) 227
MalI GATC 3 cut(s) 54, 100, 201
MboI GATC 3 cut(s) 52, 98, 199
MboII GAAGA 1 cut(s) 108
MflI RGATCY 2 cut(s) 98, 199
MluCI AATT 6 cut(s) 12, 64, 175, 186, 232, 237
MnlI CCTC 1 cut(s) 190
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeII GATC 3 cut(s) 52, 98, 199
PsuI RGATCY 2 cut(s) 98, 199
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
Sau3AI GATC 3 cut(s) 52, 98, 199
SetI ASST 1 cut(s) 145
SfaNI GCATC 1 cut(s) 227
SgeI CNNG 3 cut(s) 33, 105, 208
Sse9I AATT 6 cut(s) 12, 64, 175, 186, 232, 237
TaaI ACNGT 3 cut(s) 48, 118, 265
TaqI TCGA 1 cut(s) 8
TasI AATT 6 cut(s) 12, 64, 175, 186, 232, 237
TscAI CASTG 2 cut(s) 53, 123
TspRI CASTG 2 cut(s) 53, 123
XapI RAATTY 2 cut(s) 64, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.