Rroxscaffold_3G00226620

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
10260512 .. 10268992
8481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00226620.1

Sequence Viewer

Length: 156 bp
ATGTTGGGACATTGTGATCACAATCAGAATTCTGCTTCAGCAACAACTCATAAGTCAAGAAGATCAAAAAGAGAGGTGGAGAAAAAGAGAGAGATAGTGAAGGAGGTGGTACTGTTTGTTGGCCTCTACGATTTGGATTCGATCTTCCCTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.88

Weight (kDa)

8.98

Isoelectric Point (pI)

69.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 28
AcuI CTGAAG 1 cut(s) 21
AfaI GTAC 1 cut(s) 111
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 28
BclI TGATCA 1 cut(s) 16
BsaBI GATNNNNATC 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 21
BseJI GATNNNNATC 1 cut(s) 21
BshFI GGCC 1 cut(s) 123
BslFI GGGAC 1 cut(s) 21
BsmFI GGGAC 1 cut(s) 21
BsnI GGCC 1 cut(s) 123
Bsp143I GATC 3 cut(s) 16, 62, 141
BspANI GGCC 1 cut(s) 123
BssMI GATC 3 cut(s) 16, 62, 141
Bst4CI ACNGT 1 cut(s) 114
BstKTI GATC 3 cut(s) 19, 65, 144
BstMBI GATC 3 cut(s) 16, 62, 141
BsuRI GGCC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 110
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
CviQI GTAC 1 cut(s) 110
DpnI GATC 3 cut(s) 18, 64, 143
DpnII GATC 3 cut(s) 16, 62, 141
Eco57I CTGAAG 1 cut(s) 21
EcoRI GAATTC 1 cut(s) 28
FaiI YATR 1 cut(s) 51
FaqI GGGAC 1 cut(s) 21
FbaI TGATCA 1 cut(s) 16
FspEI CC 8 cut(s) 59, 62, 86, 89, 92, 105, 119, 137
HaeIII GGCC 1 cut(s) 123
HinfI GANTC 1 cut(s) 137
Hpy188I TCNGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 57
HpyAV CCTTC 1 cut(s) 94
HpyCH4III ACNGT 1 cut(s) 114
Ksp22I TGATCA 1 cut(s) 16
Kzo9I GATC 3 cut(s) 16, 62, 141
MalI GATC 3 cut(s) 18, 64, 143
MboI GATC 3 cut(s) 16, 62, 141
MboII GAAGA 2 cut(s) 72, 136
MluCI AATT 1 cut(s) 28
MnlI CCTC 3 cut(s) 67, 97, 134
NdeII GATC 3 cut(s) 16, 62, 141
PfeI GAWTC 1 cut(s) 137
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
Sau3AI GATC 3 cut(s) 16, 62, 141
SetI ASST 2 cut(s) 78, 108
SgeI CNNG 1 cut(s) 69
Sse9I AATT 1 cut(s) 28
TaaI ACNGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 140
TasI AATT 1 cut(s) 28
TfiI GAWTC 1 cut(s) 137
XapI RAATTY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.