RchiOBHm_Chr1g0362391

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
54055767 .. 54056114
348 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGTATACACAAGTGAAACTGTTACACTTTGGGGGATATGCTCTCCTGAGAAACTCTAGCAGTCTGTTTCATTCTTTGGGGGATATGCAGTCCTACTTTGTTGAATGGTCTTCAATGGGTTATAATAATAATGTGCTTCAAGGAAGCACCTTAAGTGGCTCAACATCAACAAATACAGATGACAGACCTTACATTTACAATCCAATGAAAAAAGGGATAAGGGAAGTTTGGCAGGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.03

Weight (kDa)

6.71

Isoelectric Point (pI)

25.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 123
AccI GTMKAC 1 cut(s) 5
AflII CTTAAG 1 cut(s) 151
AgsI TTSAA 3 cut(s) 104, 114, 140
BbsI GAAGAC 1 cut(s) 102
BfaI CTAG 1 cut(s) 57
BfrI CTTAAG 1 cut(s) 151
BpiI GAAGAC 1 cut(s) 102
BseMII CTCAG 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 39
BspTI CTTAAG 1 cut(s) 151
BssNAI GTATAC 1 cut(s) 6
Bst1107I GTATAC 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 21
BstAFI CTTAAG 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 47
BstV2I GAAGAC 1 cut(s) 102
BstZ17I GTATAC 1 cut(s) 6
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
DdeI CTNAG 1 cut(s) 47
FaiI YATR 4 cut(s) 6, 39, 86, 123
FblI GTMKAC 1 cut(s) 5
FspBI CTAG 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4III ACNGT 1 cut(s) 21
HpyCH4V TGCA 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 47
LpnPI CCDG 2 cut(s) 59, 218
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 21
MboII GAAGA 1 cut(s) 102
MseI TTAA 1 cut(s) 152
MspCI CTTAAG 1 cut(s) 151
PsiI TTATAA 1 cut(s) 123
SaqAI TTAA 1 cut(s) 152
SetI ASST 2 cut(s) 152, 190
SgeI CNNG 4 cut(s) 23, 58, 69, 152
SmlI CTYRAG 1 cut(s) 151
SmoI CTYRAG 1 cut(s) 151
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 21
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
TspDTI ATGAA 2 cut(s) 59, 221
Vha464I CTTAAG 1 cut(s) 151
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.