Rroxscaffold_6G00412270

CAAX prenyl protease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
34886111 .. 34886589
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00412270.1

Sequence Viewer

Length: 201 bp
ATGGTAGTTATGTGTGTAAATGAGTGCTTGCAGTGCAAAAATGATGAGGAAATTTTAGCTGTTCTAGCTCATGAGCTAGGCCATTGGAAGCTTAATCACAGTGGAAGCACCTTAAGTGGCTCAACATCAACAAATACAGATGACAGATCTTACGTTTACAATCCAATGAAAAAAGGGATAAGGGAAGTTTGGCAGGATTGA

Protein Analysis

66

Amino Acids

7.48

Weight (kDa)

5.45

Isoelectric Point (pI)

29.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M48 PF01435 11 - 40 2.7e-08 Peptidase family M48
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 51
AflII CTTAAG 1 cut(s) 112
AluBI AGCT 4 cut(s) 59, 68, 76, 91
AluI AGCT 4 cut(s) 59, 68, 76, 91
AoxI GGCC 1 cut(s) 79
ApoI RAATTY 1 cut(s) 51
BfaI CTAG 2 cut(s) 65, 77
BfrI CTTAAG 1 cut(s) 112
BglII AGATCT 1 cut(s) 146
BshFI GGCC 1 cut(s) 81
BsnI GGCC 1 cut(s) 81
Bsp143I GATC 1 cut(s) 146
BspANI GGCC 1 cut(s) 81
BspHI TCATGA 1 cut(s) 70
BspTI CTTAAG 1 cut(s) 112
BssMI GATC 1 cut(s) 146
Bst4CI ACNGT 1 cut(s) 101
BstAFI CTTAAG 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 29
BstKTI GATC 1 cut(s) 149
BstMBI GATC 1 cut(s) 146
BstMWI GCNNNNNNNGC 2 cut(s) 33, 65
BstX2I RGATCY 1 cut(s) 146
BstYI RGATCY 1 cut(s) 146
BsuRI GGCC 1 cut(s) 81
BtsI GCAGTG 1 cut(s) 38
BtsIMutI CAGTG 2 cut(s) 38, 106
Cac8I GCNNGC 1 cut(s) 29
CciI TCATGA 1 cut(s) 70
CviAII CATG 1 cut(s) 71
CviJI RGCY 6 cut(s) 59, 68, 76, 81, 91, 120
CviKI_1 RGCY 6 cut(s) 59, 68, 76, 81, 91, 120
DpnI GATC 1 cut(s) 148
DpnII GATC 1 cut(s) 146
FaeI CATG 1 cut(s) 74
FaiI YATR 2 cut(s) 11, 72
FatI CATG 1 cut(s) 70
FspBI CTAG 2 cut(s) 65, 77
HaeIII GGCC 1 cut(s) 81
Hin1II CATG 1 cut(s) 74
HindIII AAGCTT 1 cut(s) 89
Hpy166II GTNNAC 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 31, 36
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 65
HpySE526I ACGT 1 cut(s) 153
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 1 cut(s) 146
LpnPI CCDG 1 cut(s) 179
MaeI CTAG 2 cut(s) 65, 77
MaeII ACGT 1 cut(s) 153
MalI GATC 1 cut(s) 148
MboI GATC 1 cut(s) 146
MflI RGATCY 1 cut(s) 146
MluCI AATT 1 cut(s) 51
MnlI CCTC 1 cut(s) 40
MseI TTAA 2 cut(s) 93, 113
MspCI CTTAAG 1 cut(s) 112
MwoI GCNNNNNNNGC 2 cut(s) 33, 65
NdeII GATC 1 cut(s) 146
NlaIII CATG 1 cut(s) 74
PagI TCATGA 1 cut(s) 70
PsuI RGATCY 1 cut(s) 146
SaqAI TTAA 2 cut(s) 93, 113
Sau3AI GATC 1 cut(s) 146
SetI ASST 6 cut(s) 61, 70, 78, 93, 113, 156
SgeI CNNG 4 cut(s) 40, 77, 83, 89
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 1 cut(s) 51
SspMI CTAG 2 cut(s) 65, 77
TaaI ACNGT 1 cut(s) 101
TaiI ACGT 1 cut(s) 156
TasI AATT 1 cut(s) 51
Tru1I TTAA 2 cut(s) 93, 113
Tru9I TTAA 2 cut(s) 93, 113
TscAI CASTG 2 cut(s) 38, 106
TspDTI ATGAA 1 cut(s) 182
TspRI CASTG 2 cut(s) 38, 106
Vha464I CTTAAG 1 cut(s) 112
XapI RAATTY 1 cut(s) 51
XspI CTAG 2 cut(s) 65, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.