Rw6G028820
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
52884279 .. 52885728
1450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G028820.1

Sequence Viewer

Length: 249 bp
ATGAATCTTCAAGTGAACCTTCTTGTGTTAATTGCTGGGTTAGGTGTTCAAGATGAATATGAGGTTGTTCGGAAGGTTGGAAAAGGAAAGTACAGTGAGGTCTTCGAGGGTATAAATGTCACCAACAATGAAAAATGCGTGATCAAGATCCTTAGACCAGTCAAGAAAAAGGGAAGCACCTTAAGTGGCTCAACATCAACAAATACAGATGACAGACCTTATGTTTACAATCCAATGAAAAAGGGATAA

Protein Analysis

82

Amino Acids

9.07

Weight (kDa)

9.48

Isoelectric Point (pI)

7.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 142
AfaI GTAC 1 cut(s) 92
AflII CTTAAG 1 cut(s) 181
AgsI TTSAA 2 cut(s) 11, 50
AlwI GGATC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 94
BclI TGATCA 1 cut(s) 141
BfrI CTTAAG 1 cut(s) 181
BpiI GAAGAC 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 158
Bse8I GATNNNNATC 1 cut(s) 146
BseJI GATNNNNATC 1 cut(s) 146
BseNI ACTGG 1 cut(s) 158
BseYI CCCAGC 1 cut(s) 35
Bsp143I GATC 2 cut(s) 141, 147
BspPI GGATC 1 cut(s) 142
BspTI CTTAAG 1 cut(s) 181
BsrI ACTGG 1 cut(s) 158
BssMI GATC 2 cut(s) 141, 147
Bst4CI ACNGT 1 cut(s) 95
BstAFI CTTAAG 1 cut(s) 181
BstDEI CTNAG 1 cut(s) 152
BstKTI GATC 2 cut(s) 144, 150
BstMBI GATC 2 cut(s) 141, 147
BstV2I GAAGAC 1 cut(s) 94
BstX2I RGATCY 1 cut(s) 147
BstYI RGATCY 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 100
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 1 cut(s) 189
CviKI_1 RGCY 1 cut(s) 189
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 152
DpnI GATC 2 cut(s) 143, 149
DpnII GATC 2 cut(s) 141, 147
FaiI YATR 3 cut(s) 60, 113, 222
FalI AAGNNNNNCTT 1 cut(s) 35
FbaI TGATCA 1 cut(s) 141
GsaI CCCAGC 1 cut(s) 39
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 112
Hpy166II GTNNAC 2 cut(s) 16, 226
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 3 cut(s) 50, 145, 163
Hpy8I GTNNAC 2 cut(s) 16, 226
HpyAV CCTTC 2 cut(s) 29, 67
HpyCH4III ACNGT 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 152
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 2 cut(s) 141, 147
LpnPI CCDG 2 cut(s) 21, 171
MaeIII GTNAC 1 cut(s) 118
MalI GATC 2 cut(s) 143, 149
MboI GATC 2 cut(s) 141, 147
MboII GAAGA 1 cut(s) 94
MflI RGATCY 1 cut(s) 147
MluCI AATT 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 58
MnlI CCTC 3 cut(s) 55, 91, 100
MseI TTAA 2 cut(s) 29, 182
MspCI CTTAAG 1 cut(s) 181
NdeII GATC 2 cut(s) 141, 147
NmuCI GTSAC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 4
PspFI CCCAGC 1 cut(s) 35
PsuI RGATCY 1 cut(s) 147
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SaqAI TTAA 2 cut(s) 29, 182
Sau3AI GATC 2 cut(s) 141, 147
SetI ASST 7 cut(s) 21, 46, 66, 78, 102, 182, 220
SgeI CNNG 9 cut(s) 23, 35, 48, 62, 118, 151, 157, 170, 175
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
Sse9I AATT 1 cut(s) 30
TaaI ACNGT 1 cut(s) 95
TaqI TCGA 1 cut(s) 105
TasI AATT 1 cut(s) 30
TatI WGTACW 1 cut(s) 90
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 29, 182
Tru9I TTAA 2 cut(s) 29, 182
TscAI CASTG 1 cut(s) 100
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspDTI ATGAA 3 cut(s) 17, 69, 144
TspRI CASTG 1 cut(s) 100
Vha464I CTTAAG 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.