Rh6AG235600

CAAX prenyl protease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
42017968 .. 42018464
497 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG235600.1

Sequence Viewer

Length: 264 bp
ATGGTAGATGCCTATATGTATGGATTTTTTAAGAACAAGAGGATTGTCCTTTATGATACACTGATCCAGCAGTGCAAAAATGATGAGGAAATTGTAGCTATTCTAGCTCATGAGCTAGGCCATTGGAAGCTTAATCACAGTGTATACTTATTCATTTCTATACAGATCCGTACGCTGTTACACTTTGGGGGATATGCTCTCCTGAGAAACTCCAGCAGTCTATTTCATACTTTGGGGGATATGCAGTCCTACTTTGTTGAATGA

Protein Analysis

87

Amino Acids

10.22

Weight (kDa)

6.49

Isoelectric Point (pI)

38.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M48 PF01435 2 - 79 6.1e-21 Peptidase family M48
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 144
AclWI GGATC 2 cut(s) 58, 160
AfaI GTAC 1 cut(s) 172
AgsI TTSAA 1 cut(s) 260
AluBI AGCT 4 cut(s) 98, 107, 115, 130
AluI AGCT 4 cut(s) 98, 107, 115, 130
AlwI GGATC 2 cut(s) 58, 160
AoxI GGCC 1 cut(s) 118
BfaI CTAG 2 cut(s) 104, 116
BpmI CTGGAG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 194
BshFI GGCC 1 cut(s) 120
BsiWI CGTACG 1 cut(s) 170
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 63, 165
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 195
BspHI TCATGA 1 cut(s) 109
BspPI GGATC 2 cut(s) 58, 160
BssMI GATC 2 cut(s) 63, 165
BssNAI GTATAC 1 cut(s) 145
Bst1107I GTATAC 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 203
BstKTI GATC 2 cut(s) 66, 168
BstMBI GATC 2 cut(s) 63, 165
BstMWI GCNNNNNNNGC 1 cut(s) 104
BstX2I RGATCY 1 cut(s) 165
BstYI RGATCY 1 cut(s) 165
BstZ17I GTATAC 1 cut(s) 145
BsuRI GGCC 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 77
BtsIMutI CAGTG 3 cut(s) 59, 77, 145
CciI TCATGA 1 cut(s) 109
Csp6I GTAC 1 cut(s) 171
CviAII CATG 1 cut(s) 110
CviJI RGCY 5 cut(s) 98, 107, 115, 120, 130
CviKI_1 RGCY 5 cut(s) 98, 107, 115, 120, 130
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 203
DpnI GATC 2 cut(s) 65, 167
DpnII GATC 2 cut(s) 63, 165
FaeI CATG 1 cut(s) 113
FatI CATG 1 cut(s) 109
FblI GTMKAC 1 cut(s) 144
FspBI CTAG 2 cut(s) 104, 116
GsuI CTGGAG 1 cut(s) 196
HaeIII GGCC 1 cut(s) 120
Hin1II CATG 1 cut(s) 113
HindIII AAGCTT 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 110, 202
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 140
HpyCH4V TGCA 2 cut(s) 75, 244
HpyF10VI GCNNNNNNNGC 1 cut(s) 104
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 1 cut(s) 113
Kzo9I GATC 2 cut(s) 63, 165
LpnPI CCDG 3 cut(s) 80, 215, 226
MaeI CTAG 2 cut(s) 104, 116
MaeIII GTNAC 1 cut(s) 177
MalI GATC 2 cut(s) 65, 167
MboI GATC 2 cut(s) 63, 165
MflI RGATCY 1 cut(s) 165
MluCI AATT 1 cut(s) 90
MnlI CCTC 2 cut(s) 33, 79
MseI TTAA 2 cut(s) 30, 132
MwoI GCNNNNNNNGC 1 cut(s) 104
NdeII GATC 2 cut(s) 63, 165
NlaIII CATG 1 cut(s) 113
PagI TCATGA 1 cut(s) 109
Pfl23II CGTACG 1 cut(s) 170
PspLI CGTACG 1 cut(s) 170
PsuI RGATCY 1 cut(s) 165
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
SaqAI TTAA 2 cut(s) 30, 132
Sau3AI GATC 2 cut(s) 63, 165
SetI ASST 4 cut(s) 100, 109, 117, 132
SgeI CNNG 7 cut(s) 49, 79, 116, 122, 128, 214, 225
Sse9I AATT 1 cut(s) 90
SspMI CTAG 2 cut(s) 104, 116
TaaI ACNGT 1 cut(s) 140
TasI AATT 1 cut(s) 90
Tru1I TTAA 2 cut(s) 30, 132
Tru9I TTAA 2 cut(s) 30, 132
TscAI CASTG 3 cut(s) 66, 77, 145
TspDTI ATGAA 2 cut(s) 142, 215
TspGWI ACGGA 1 cut(s) 158
TspRI CASTG 3 cut(s) 66, 77, 145
XmiI GTMKAC 1 cut(s) 144
XspI CTAG 2 cut(s) 104, 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.