RchiOBHm_Chr1g0340761

Dehydrogenase reductase SDR family member on chromosome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
32310784 .. 32311632
849 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56752

Sequence Viewer

Length: 282 bp
ATGATGGAAATTAAGAGGAAGACTGAGAGAAGGAAGCTTTCGAGGTTGATCTCTCATCATTCCAGTCGATTCTTCAGTTTAAAAGCCTCCCTACAGCAGTGGCTTTTCGACTCACAAATGCAGTACTCTTCAATCCAACTCCTAATTAACAATGCTGGAATATTTGCTACATCGTCTAGATTCACCTCTGAAGGCTATGTGCTGGTGGATCGTGGTGTTGTTGAAACCAAAATCATGCGAGAAGTTCCTCATGCCTATCCATTTTGGCTTTCAAAGTTTTGA
Functional Annotation

Protein Analysis

93

Amino Acids

10.99

Weight (kDa)

10.27

Isoelectric Point (pI)

45.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 216
AcuI CTGAAG 2 cut(s) 58, 210
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 3 cut(s) 132, 224, 273
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
AlwI GGATC 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 26
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 92
BmcAI AGTACT 1 cut(s) 125
BpiI GAAGAC 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 63
Bsp143I GATC 2 cut(s) 48, 208
BspCNI CTCAG 1 cut(s) 16
BspPI GGATC 1 cut(s) 216
BsrI ACTGG 1 cut(s) 63
BssMI GATC 2 cut(s) 48, 208
Bst6I CTCTTC 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 2 cut(s) 51, 211
BstMBI GATC 2 cut(s) 48, 208
BstSFI CTRYAG 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 104
BtsIMutI CAGTG 1 cut(s) 104
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 235, 251
CviJI RGCY 5 cut(s) 37, 86, 103, 195, 268
CviKI_1 RGCY 5 cut(s) 37, 86, 103, 195, 268
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 50, 210
DpnII GATC 2 cut(s) 48, 208
DraI TTTAAA 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 133
EarI CTCTTC 1 cut(s) 133
Eco57I CTGAAG 2 cut(s) 58, 210
FaeI CATG 2 cut(s) 238, 254
FaiI YATR 3 cut(s) 198, 236, 252
FatI CATG 2 cut(s) 234, 250
FspBI CTAG 1 cut(s) 177
Hin1II CATG 2 cut(s) 238, 254
HindIII AAGCTT 1 cut(s) 35
HinfI GANTC 3 cut(s) 69, 110, 180
HphI GGTGA 1 cut(s) 175
Hpy188I TCNGA 1 cut(s) 190
Hpy188III TCNNGA 1 cut(s) 177
HpyAV CCTTC 2 cut(s) 24, 185
HpyCH4V TGCA 1 cut(s) 121
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 2 cut(s) 238, 254
Kzo9I GATC 2 cut(s) 48, 208
LpnPI CCDG 3 cut(s) 76, 141, 188
MaeI CTAG 1 cut(s) 177
MalI GATC 2 cut(s) 50, 210
MboI GATC 2 cut(s) 48, 208
MboII GAAGA 3 cut(s) 31, 64, 120
MluCI AATT 2 cut(s) 9, 144
MlyI GAGTC 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 5 cut(s) 9, 36, 97, 196, 258
MseI TTAA 3 cut(s) 12, 80, 147
NdeII GATC 2 cut(s) 48, 208
NlaIII CATG 2 cut(s) 238, 254
PfeI GAWTC 2 cut(s) 69, 180
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SaqAI TTAA 3 cut(s) 12, 80, 147
Sau3AI GATC 2 cut(s) 48, 208
ScaI AGTACT 1 cut(s) 125
SchI GAGTC 1 cut(s) 104
SetI ASST 3 cut(s) 39, 47, 188
SfcI CTRYAG 1 cut(s) 92
SgeI CNNG 9 cut(s) 54, 75, 168, 189, 215, 224, 247, 251, 263
Sse9I AATT 2 cut(s) 9, 144
SspI AATATT 1 cut(s) 162
SspMI CTAG 1 cut(s) 177
TaqI TCGA 3 cut(s) 41, 67, 108
TasI AATT 2 cut(s) 9, 144
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 2 cut(s) 69, 180
Tru1I TTAA 3 cut(s) 12, 80, 147
Tru9I TTAA 3 cut(s) 12, 80, 147
TscAI CASTG 1 cut(s) 104
TspRI CASTG 1 cut(s) 104
XbaI TCTAGA 1 cut(s) 176
XspI CTAG 1 cut(s) 177
ZrmI AGTACT 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.