Rmu_sc0006671.1_g000001

Dehydrogenase reductase SDR family member on chromosome

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006671.1
Physical Location & Seq
Forward (+)
1331 .. 1694
364 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006671.1_g000001.1.cds

Sequence Viewer

Length: 270 bp
atgcaattctactatggactctcactcttctcatctcttactggaacctccttttcgcctcgattactcctccttccagatcatcacctcgctcacgcctactttgtggttcttgttggacgctcatctcacttgttagaaaaggtacctaatctcctcggctttcaaatttccgactcacaaatgcactcttcaatccaactcctaattaacaatgctggaatatttgctacatcgtctagattcaccgccgaaggctatgatcagtaa
Functional Annotation

Protein Analysis

89

Amino Acids

9.9

Weight (kDa)

6.48

Isoelectric Point (pI)

42.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 145
AccB1I GGYRCC 1 cut(s) 145
AciI CCGC 1 cut(s) 249
AcsI RAATTY 1 cut(s) 168
AfaI GTAC 1 cut(s) 147
AgsI TTSAA 2 cut(s) 167, 195
ApoI RAATTY 1 cut(s) 168
Asp718I GGTACC 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 77, 238
BanI GGYRCC 1 cut(s) 145
BclI TGATCA 1 cut(s) 262
BfaI CTAG 1 cut(s) 240
BmiI GGNNCC 2 cut(s) 46, 147
BsaJI CCNNGG 1 cut(s) 157
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bse1I ACTGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 157
BseNI ACTGG 1 cut(s) 46
BseRI GAGGAG 2 cut(s) 59, 146
BshNI GGYRCC 1 cut(s) 145
Bsp143I GATC 2 cut(s) 79, 262
BspACI CCGC 1 cut(s) 249
BspLI GGNNCC 2 cut(s) 46, 147
BspT107I GGYRCC 1 cut(s) 145
BsrI ACTGG 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 157
BssMI GATC 2 cut(s) 79, 262
Bst6I CTCTTC 2 cut(s) 32, 196
BstKTI GATC 2 cut(s) 82, 265
BstMBI GATC 2 cut(s) 79, 262
CseI GACGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 146
CviJI RGCY 2 cut(s) 162, 258
CviKI_1 RGCY 2 cut(s) 162, 258
CviQI GTAC 1 cut(s) 146
DpnI GATC 2 cut(s) 81, 264
DpnII GATC 2 cut(s) 79, 262
Eam1104I CTCTTC 2 cut(s) 32, 196
EarI CTCTTC 2 cut(s) 32, 196
FaiI YATR 2 cut(s) 15, 261
FbaI TGATCA 1 cut(s) 262
FspBI CTAG 1 cut(s) 240
HgaI GACGC 1 cut(s) 129
HinfI GANTC 3 cut(s) 18, 176, 243
HphI GGTGA 2 cut(s) 77, 238
Hpy188I TCNGA 1 cut(s) 175
Hpy188III TCNNGA 2 cut(s) 77, 240
HpyAV CCTTC 2 cut(s) 83, 248
HpyCH4V TGCA 2 cut(s) 4, 187
KpnI GGTACC 1 cut(s) 149
Ksp22I TGATCA 1 cut(s) 262
Kzo9I GATC 2 cut(s) 79, 262
LpnPI CCDG 3 cut(s) 27, 90, 204
MaeI CTAG 1 cut(s) 240
MalI GATC 2 cut(s) 81, 264
MboI GATC 2 cut(s) 79, 262
MboII GAAGA 2 cut(s) 19, 183
MluCI AATT 3 cut(s) 5, 168, 207
MlyI GAGTC 2 cut(s) 12, 170
MmeI TCCRAC 3 cut(s) 97, 198, 223
MnlI CCTC 5 cut(s) 58, 69, 80, 98, 167
MseI TTAA 1 cut(s) 210
NdeII GATC 2 cut(s) 79, 262
NlaIV GGNNCC 2 cut(s) 46, 147
NmeAIII GCCGAG 1 cut(s) 138
PfeI GAWTC 1 cut(s) 243
PleI GAGTC 2 cut(s) 12, 170
PpsI GAGTC 2 cut(s) 12, 170
PspN4I GGNNCC 2 cut(s) 46, 147
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 1 cut(s) 210
Sau3AI GATC 2 cut(s) 79, 262
SchI GAGTC 2 cut(s) 12, 170
SetI ASST 4 cut(s) 50, 90, 147, 151
Sse9I AATT 3 cut(s) 5, 168, 207
SsiI CCGC 1 cut(s) 249
SspI AATATT 1 cut(s) 225
SspMI CTAG 1 cut(s) 240
TaqI TCGA 1 cut(s) 61
TasI AATT 3 cut(s) 5, 168, 207
TfiI GAWTC 1 cut(s) 243
Tru1I TTAA 1 cut(s) 210
Tru9I TTAA 1 cut(s) 210
XapI RAATTY 1 cut(s) 168
XbaI TCTAGA 1 cut(s) 239
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.