RchiOBHm_Chr7g0230151

Dehydrogenase reductase SDR family member on chromosome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
53604366 .. 53605720
1355 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20620

Sequence Viewer

Length: 138 bp
ATGGCTACAAATTACTTGAGTGCATTTTCTCTTCGTAAACTATTATCACCACTTCTCAGAAACAGCCCAGTTCCTTCCTGTATATTGAATGTCACATCTTTCACACATCGAAGTGTATTGAATATACAGGTTGACTAG
Functional Annotation

Protein Analysis

45

Amino Acids

5.02

Weight (kDa)

10.04

Isoelectric Point (pI)

75.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 88, 121
AsuHPI GGTGA 1 cut(s) 39
BfaI CTAG 1 cut(s) 136
BmrI ACTGGG 1 cut(s) 62
BmuI ACTGGG 1 cut(s) 62
BpuEI CTTGAG 1 cut(s) 37
Bse1I ACTGG 1 cut(s) 68
BseMII CTCAG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 68
BspCNI CTCAG 1 cut(s) 69
BsrI ACTGG 1 cut(s) 68
Bst6I CTCTTC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 56
CviJI RGCY 2 cut(s) 5, 66
CviKI_1 RGCY 2 cut(s) 5, 66
DdeI CTNAG 1 cut(s) 56
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
FaiI YATR 2 cut(s) 83, 125
FspBI CTAG 1 cut(s) 136
FspEI CC 6 cut(s) 63, 80, 81, 87, 91, 113
HincII GTYRAC 1 cut(s) 133
HindII GTYRAC 1 cut(s) 133
HphI GGTGA 1 cut(s) 39
Hpy166II GTNNAC 2 cut(s) 38, 133
Hpy188I TCNGA 1 cut(s) 59
Hpy8I GTNNAC 2 cut(s) 38, 133
HpyAV CCTTC 1 cut(s) 84
HpyCH4V TGCA 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 56
LpnPI CCDG 3 cut(s) 81, 91, 113
MaeI CTAG 1 cut(s) 136
MaeIII GTNAC 1 cut(s) 91
MboII GAAGA 1 cut(s) 23
MluCI AATT 1 cut(s) 10
MslI CAYNNNNRTG 1 cut(s) 111
NmuCI GTSAC 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 111
SetI ASST 1 cut(s) 132
SgeI CNNG 3 cut(s) 28, 80, 90
SmiMI CAYNNNNRTG 1 cut(s) 111
SmlI CTYRAG 1 cut(s) 16
SmoI CTYRAG 1 cut(s) 16
Sse9I AATT 1 cut(s) 10
SspMI CTAG 1 cut(s) 136
TaqI TCGA 1 cut(s) 109
TasI AATT 1 cut(s) 10
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
XspI CTAG 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.