RchiOBHm_Chr7g0222771

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
44423543 .. 44424537
995 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19942

Sequence Viewer

Length: 150 bp
ATGATCTGTAATAGTTCTGTATCAATGTTCACACATTTGGGGATTGTAGTTACAGTTGCCACTGGTTTTGGAGTGAAAACTACTATTGCTCTTTGGGTTCAGAGAATCCAGAAAGAAAGCGTGGGATATCTAGCCCCATTTAGCGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.29

Weight (kDa)

9.19

Isoelectric Point (pI)

17.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
BfaI CTAG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 67
Bsp143I GATC 1 cut(s) 3
BsrI ACTGG 1 cut(s) 67
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 55
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BtsIMutI CAGTG 1 cut(s) 60
CspCI CAANNNNNGTGG 2 cut(s) 49, 84
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco32I GATATC 1 cut(s) 128
EcoRV GATATC 1 cut(s) 128
FspBI CTAG 1 cut(s) 131
HinfI GANTC 1 cut(s) 105
Hpy166II GTNNAC 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 55
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 48, 122
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MseI TTAA 1 cut(s) 148
NdeII GATC 1 cut(s) 3
PfeI GAWTC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 148
Sau3AI GATC 1 cut(s) 3
SgeI CNNG 4 cut(s) 75, 121, 133, 143
SspMI CTAG 1 cut(s) 131
TaaI ACNGT 1 cut(s) 55
TfiI GAWTC 1 cut(s) 105
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TscAI CASTG 1 cut(s) 67
TspRI CASTG 1 cut(s) 67
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.