Rh1CG164300

Dehydrogenase reductase SDR family member on chromosome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0005207
Physical Location & Seq
Reverse (-)
36269049 .. 36273853
4805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG164300.1

Sequence Viewer

Length: 474 bp
ATGTGTATAGCTCATAATCAAATCCTGTATGCAGTTGGTCGCTCATCTCACTTGTTAGAAAAGACGATGATGGAAATTAAGAGGAAGACTGAGAGAAGGAAGCTTTCGAGGTTGATCTCTCATCATTCCAGTTGGTTCTTCAGTTTAAAAGCCTCCCTACAGCAGTGGCTTTTCGACTCACAAATGCAGTACTCTTCAATCCAACTCCTAATTAACAATGCTGGAATATTTGCTACATCGTCTAGATTCACCTCTGAAGGCTATGATCAAATGATGGCTACAGAGTACTTGAGTGCATTTTCTCTTACTAAACTATTATCACCACTTCTCAGAAACAGCCCAGTTCCTTCCCGTATTGCGAATGTCACATCTTTCACACATCCAATTAGTATGCTGGTGGATCCTGGTGTTGTTGAAACCAACATCATGCGAGAAGTTCCTCATTCCTATCCAGTTTGGCTTTCAAAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576 GO:0008150 GO:0009893 GO:0009894 GO:0009896 GO:0010506 GO:0010508 GO:0019222 GO:0031323 GO:0031325 GO:0031329 GO:0031331 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0065007
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
adh_short

Protein Analysis

157

Amino Acids

18.03

Weight (kDa)

9.72

Isoelectric Point (pI)

54.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
adh_short PF00106 50 - 125 1.2e-07 short chain dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 395, 408
AcuI CTGAAG 2 cut(s) 124, 276
AfaI GTAC 2 cut(s) 191, 287
AgsI TTSAA 3 cut(s) 198, 416, 465
AjnI CCWGG 1 cut(s) 403
AluBI AGCT 2 cut(s) 11, 103
AluI AGCT 2 cut(s) 11, 103
AlwI GGATC 2 cut(s) 395, 408
AsuHPI GGTGA 2 cut(s) 241, 312
BamHI GGATCC 1 cut(s) 400
BbsI GAAGAC 1 cut(s) 92
BccI CCATC 2 cut(s) 64, 268
BciT130I CCWGG 1 cut(s) 405
BclI TGATCA 1 cut(s) 265
BfaI CTAG 1 cut(s) 243
BfmI CTRYAG 2 cut(s) 158, 279
BmcAI AGTACT 2 cut(s) 191, 287
Bme1390I CCNGG 1 cut(s) 405
BmiI GGNNCC 1 cut(s) 402
BmrFI CCNGG 1 cut(s) 405
BmrI ACTGGG 1 cut(s) 335
BmuI ACTGGG 1 cut(s) 335
BpiI GAAGAC 1 cut(s) 92
BpuEI CTTGAG 1 cut(s) 310
Bse1I ACTGG 3 cut(s) 129, 341, 452
BseBI CCWGG 1 cut(s) 405
BseGI GGATG 1 cut(s) 379
BseMII CTCAG 2 cut(s) 81, 343
BseNI ACTGG 3 cut(s) 129, 341, 452
Bsp143I GATC 3 cut(s) 114, 265, 400
BspCNI CTCAG 2 cut(s) 82, 342
BspLI GGNNCC 1 cut(s) 402
BspPI GGATC 2 cut(s) 395, 408
BsrI ACTGG 3 cut(s) 129, 341, 452
BssMI GATC 3 cut(s) 114, 265, 400
Bst2UI CCWGG 1 cut(s) 405
Bst6I CTCTTC 1 cut(s) 199
BstDEI CTNAG 2 cut(s) 90, 329
BstF5I GGATG 1 cut(s) 379
BstKTI GATC 3 cut(s) 117, 268, 403
BstMBI GATC 3 cut(s) 114, 265, 400
BstNI CCWGG 1 cut(s) 405
BstSCI CCNGG 1 cut(s) 403
BstSFI CTRYAG 2 cut(s) 158, 279
BstV2I GAAGAC 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 400
BstYI RGATCY 1 cut(s) 400
BtsCI GGATG 1 cut(s) 379
BtsI GCAGTG 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 170
Csp6I GTAC 2 cut(s) 190, 286
CviAII CATG 1 cut(s) 427
CviJI RGCY 8 cut(s) 11, 103, 152, 169, 261, 278, 339, 460
CviKI_1 RGCY 8 cut(s) 11, 103, 152, 169, 261, 278, 339, 460
CviQI GTAC 2 cut(s) 190, 286
DdeI CTNAG 2 cut(s) 90, 329
DpnI GATC 3 cut(s) 116, 267, 402
DpnII GATC 3 cut(s) 114, 265, 400
DraI TTTAAA 1 cut(s) 147
Eam1104I CTCTTC 1 cut(s) 199
EarI CTCTTC 1 cut(s) 199
Eco57I CTGAAG 2 cut(s) 124, 276
EcoRII CCWGG 1 cut(s) 403
FaeI CATG 1 cut(s) 430
FaiI YATR 6 cut(s) 8, 15, 30, 264, 392, 428
FatI CATG 1 cut(s) 426
FbaI TGATCA 1 cut(s) 265
FokI GGATG 1 cut(s) 366
FspBI CTAG 1 cut(s) 243
Hin1II CATG 1 cut(s) 430
HindIII AAGCTT 1 cut(s) 101
HinfI GANTC 2 cut(s) 176, 246
HphI GGTGA 2 cut(s) 241, 312
Hpy188I TCNGA 2 cut(s) 256, 332
Hpy188III TCNNGA 1 cut(s) 243
HpyAV CCTTC 3 cut(s) 90, 251, 357
HpyCH4V TGCA 3 cut(s) 32, 187, 296
HpyF3I CTNAG 2 cut(s) 90, 329
Hsp92II CATG 1 cut(s) 430
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 3 cut(s) 114, 265, 400
LpnPI CCDG 8 cut(s) 38, 142, 207, 354, 380, 390, 417, 465
MaeI CTAG 1 cut(s) 243
MaeIII GTNAC 1 cut(s) 364
MalI GATC 3 cut(s) 116, 267, 402
MboI GATC 3 cut(s) 114, 265, 400
MboII GAAGA 3 cut(s) 97, 130, 186
MflI RGATCY 1 cut(s) 400
MluCI AATT 3 cut(s) 75, 210, 384
MlyI GAGTC 1 cut(s) 170
MmeI TCCRAC 1 cut(s) 226
MnlI CCTC 5 cut(s) 75, 102, 163, 262, 450
MseI TTAA 3 cut(s) 78, 146, 213
MspR9I CCNGG 1 cut(s) 405
MvaI CCWGG 1 cut(s) 405
NdeII GATC 3 cut(s) 114, 265, 400
NlaIII CATG 1 cut(s) 430
NlaIV GGNNCC 1 cut(s) 402
NmuCI GTSAC 1 cut(s) 364
PfeI GAWTC 1 cut(s) 246
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
Psp6I CCWGG 1 cut(s) 403
PspGI CCWGG 1 cut(s) 403
PspN4I GGNNCC 1 cut(s) 402
PsuI RGATCY 1 cut(s) 400
RsaI GTAC 2 cut(s) 191, 287
RsaNI GTAC 2 cut(s) 190, 286
SaqAI TTAA 3 cut(s) 78, 146, 213
Sau3AI GATC 3 cut(s) 114, 265, 400
ScaI AGTACT 2 cut(s) 191, 287
SchI GAGTC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 405
SetI ASST 4 cut(s) 13, 105, 113, 254
SfcI CTRYAG 2 cut(s) 158, 279
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 3 cut(s) 75, 210, 384
SspI AATATT 1 cut(s) 228
SspMI CTAG 1 cut(s) 243
StyD4I CCNGG 1 cut(s) 403
TaqI TCGA 2 cut(s) 107, 174
TasI AATT 3 cut(s) 75, 210, 384
TatI WGTACW 2 cut(s) 189, 285
TfiI GAWTC 1 cut(s) 246
Tru1I TTAA 3 cut(s) 78, 146, 213
Tru9I TTAA 3 cut(s) 78, 146, 213
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 1 cut(s) 364
Tsp45I GTSAC 1 cut(s) 364
TspRI CASTG 1 cut(s) 170
XbaI TCTAGA 1 cut(s) 242
XspI CTAG 1 cut(s) 243
ZrmI AGTACT 2 cut(s) 191, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.