RchiOBHm_Chr1g0356921

Protein RIC1 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
49316329 .. 49317923
1595 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58223

Sequence Viewer

Length: 222 bp
ATGTCATTTTCAGCCTGCAGAGAGTTTCCATTTATTGAGCCAACACCTCAAGCTCAAACTATATTACCTTGTCTTCTAAGGCACCTTAATCAGGGACAAAAGGGAGGAAGCTTTAAGGTTGGCCAATTATTAGCAGAAAAACCTCATTTCTCTCATTGTATGGAGTGGCTTCTGTTTACTGTATTTGATCGGACATATCCAGGCAAAGTGCTCTGTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.3

Weight (kDa)

8.46

Isoelectric Point (pI)

47.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 81
AcoI YGGCCR 1 cut(s) 121
AfiI CCNNNNNNNGG 1 cut(s) 91
AjnI CCWGG 1 cut(s) 199
AluBI AGCT 2 cut(s) 53, 111
AluI AGCT 2 cut(s) 53, 111
Alw21I GWGCWC 1 cut(s) 213
AoxI GGCC 1 cut(s) 121
BalI TGGCCA 1 cut(s) 123
BanI GGYRCC 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 65
Bbv12I GWGCWC 1 cut(s) 213
BciT130I CCWGG 1 cut(s) 201
BfmI CTRYAG 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 83
BmrFI CCNGG 1 cut(s) 201
BpiI GAAGAC 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 201
BseLI CCNNNNNNNGG 1 cut(s) 91
BshFI GGCC 1 cut(s) 123
BshNI GGYRCC 1 cut(s) 81
BsiHKAI GWGCWC 1 cut(s) 213
BslFI GGGAC 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 91
BsmFI GGGAC 1 cut(s) 108
BsnI GGCC 1 cut(s) 123
Bsp1286I GDGCHC 1 cut(s) 213
Bsp143I GATC 1 cut(s) 187
BspANI GGCC 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 83
BspMAI CTGCAG 1 cut(s) 20
BspT107I GGYRCC 1 cut(s) 81
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 201
Bst4CI ACNGT 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 77
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 65
BsuRI GGCC 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 16
CviJI RGCY 6 cut(s) 14, 40, 53, 111, 123, 169
CviKI_1 RGCY 6 cut(s) 14, 40, 53, 111, 123, 169
DdeI CTNAG 1 cut(s) 77
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
EaeI YGGCCR 1 cut(s) 121
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 199
FaiI YATR 3 cut(s) 62, 161, 196
FaqI GGGAC 1 cut(s) 108
HaeIII GGCC 1 cut(s) 123
HindIII AAGCTT 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 192
Hpy8I GTNNAC 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 18
HpyF3I CTNAG 1 cut(s) 77
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 4 cut(s) 28, 77, 186, 213
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 1 cut(s) 65
MhlI GDGCHC 1 cut(s) 213
MlsI TGGCCA 1 cut(s) 123
MluCI AATT 1 cut(s) 125
MluNI TGGCCA 1 cut(s) 123
MnlI CCTC 3 cut(s) 57, 98, 153
Mox20I TGGCCA 1 cut(s) 123
MscI TGGCCA 1 cut(s) 123
MseI TTAA 3 cut(s) 87, 114, 220
Msp20I TGGCCA 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NdeII GATC 1 cut(s) 187
NlaIV GGNNCC 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 83
PstI CTGCAG 1 cut(s) 20
SaqAI TTAA 3 cut(s) 87, 114, 220
Sau3AI GATC 1 cut(s) 187
ScrFI CCNGG 1 cut(s) 201
SduI GDGCHC 1 cut(s) 213
SetI ASST 7 cut(s) 49, 55, 70, 87, 113, 120, 145
SfcI CTRYAG 1 cut(s) 16
SgeI CNNG 6 cut(s) 27, 62, 81, 104, 212, 213
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
Sse9I AATT 1 cut(s) 125
StyD4I CCNGG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 181
TasI AATT 1 cut(s) 125
Tru1I TTAA 3 cut(s) 87, 114, 220
Tru9I TTAA 3 cut(s) 87, 114, 220
XagI CCTNNNNNAGG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.