RchiOBHm_Chr3g0459601

Translin-associated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
8006149 .. 8006337
189 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42619

Sequence Viewer

Length: 189 bp
ATGAATGCTACTTTGCTACCACTCAGTGATCCGTCTCTTGAGCCTTTGCAGATCAATGTCTTTGACTATCTCCTAGGGCTTGCAGATTTGACTAGAAAGCTGATGCGGTTGGCAATTGGTCGAATTTCAGATGGTGAAGTTGAATTTGCTGAGGACATATGCAAGTTTATGCGTGAAAATTTACAATGA
Functional Annotation

Protein Analysis

62

Amino Acids

7.04

Weight (kDa)

4.46

Isoelectric Point (pI)

28.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Translin PF01997 8 - 59 5.4e-10 Translin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 106
AclWI GGATC 1 cut(s) 23
AcsI RAATTY 3 cut(s) 123, 143, 178
AdeI CACNNNGTG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 143
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 39
AlwI GGATC 1 cut(s) 23
ApoI RAATTY 3 cut(s) 123, 143, 178
AspA2I CCTAGG 1 cut(s) 73
AsuHPI GGTGA 1 cut(s) 146
AvrII CCTAGG 1 cut(s) 73
BbvCI CCTCAGC 1 cut(s) 150
BccI CCATC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 2 cut(s) 74, 93
BlnI CCTAGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 93
Bpu10I CCTNAGC 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 73
BseMII CTCAG 2 cut(s) 37, 141
BsmAI GTCTC 1 cut(s) 39
BsmBI CGTCTC 1 cut(s) 39
BsmI GAATGC 1 cut(s) 10
Bsp143I GATC 2 cut(s) 28, 51
BspACI CCGC 1 cut(s) 106
BspCNI CTCAG 2 cut(s) 36, 142
BspPI GGATC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 73
BssMI GATC 2 cut(s) 28, 51
BssT1I CCWWGG 1 cut(s) 73
BstC8I GCNNGC 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 23, 150
BstKTI GATC 2 cut(s) 31, 54
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 28, 51
BtsIMutI CAGTG 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 81
CviJI RGCY 3 cut(s) 43, 79, 100
CviKI_1 RGCY 3 cut(s) 43, 79, 100
DdeI CTNAG 2 cut(s) 23, 150
DpnI GATC 2 cut(s) 30, 53
DpnII GATC 2 cut(s) 28, 51
DraIII CACNNNGTG 1 cut(s) 26
Eco130I CCWWGG 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
Esp3I CGTCTC 1 cut(s) 39
FaiI YATR 3 cut(s) 158, 160, 170
FauNDI CATATG 1 cut(s) 158
FspBI CTAG 2 cut(s) 74, 93
HphI GGTGA 1 cut(s) 146
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 38
HpyCH4V TGCA 3 cut(s) 49, 83, 162
HpyF3I CTNAG 2 cut(s) 23, 150
Kzo9I GATC 2 cut(s) 28, 51
LweI GCATC 1 cut(s) 93
MaeI CTAG 2 cut(s) 74, 93
MalI GATC 2 cut(s) 30, 53
MboI GATC 2 cut(s) 28, 51
MfeI CAATTG 1 cut(s) 114
MluCI AATT 4 cut(s) 114, 123, 143, 178
MnlI CCTC 1 cut(s) 145
MunI CAATTG 1 cut(s) 114
Mva1269I GAATGC 1 cut(s) 10
NdeI CATATG 1 cut(s) 158
NdeII GATC 2 cut(s) 28, 51
PctI GAATGC 1 cut(s) 10
Sau3AI GATC 2 cut(s) 28, 51
SetI ASST 1 cut(s) 102
SfaNI GCATC 1 cut(s) 93
SgeI CNNG 6 cut(s) 50, 86, 92, 105, 175, 185
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 4 cut(s) 114, 123, 143, 178
SsiI CCGC 1 cut(s) 106
SspMI CTAG 2 cut(s) 74, 93
StyI CCWWGG 1 cut(s) 73
TaqI TCGA 1 cut(s) 121
TasI AATT 4 cut(s) 114, 123, 143, 178
TscAI CASTG 1 cut(s) 31
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 21
TspRI CASTG 1 cut(s) 31
XapI RAATTY 3 cut(s) 123, 143, 178
XmaJI CCTAGG 1 cut(s) 73
XspI CTAG 2 cut(s) 74, 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.