RchiOBHm_Chr3g0493651

callose synthase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
40937560 .. 40939928
2369 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45639

Sequence Viewer

Length: 177 bp
ATGTTTGACCATATGGCGAAGGAGTTAGATGCTATTCCTGCTGCTGGCTGCACAATAGAAAATGATTATGTGTCCTTCCTCAAGCAGATTGTTTATCCTATGCATGAAACATTGGCAGCGGAAGCTGCTGGAAACAATAATGGGAAAGCTGCGCATTTCAGCGTGGCGGAATTATGA

Protein Analysis

58

Amino Acids

6.27

Weight (kDa)

4.76

Isoelectric Point (pI)

31.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 153
AciI CCGC 2 cut(s) 119, 167
AfiI CCNNNNNNNGG 1 cut(s) 44
AluBI AGCT 2 cut(s) 125, 149
AluI AGCT 2 cut(s) 125, 149
ApeKI GCWGC 5 cut(s) 41, 48, 116, 125, 149
AspLEI GCGC 1 cut(s) 154
BbvI GCAGC 5 cut(s) 28, 35, 112, 128, 136
BisI GCNGC 5 cut(s) 42, 49, 117, 126, 150
BlsI GCNGC 5 cut(s) 43, 50, 118, 127, 151
BmsI GCATC 1 cut(s) 19
BpuEI CTTGAG 1 cut(s) 65
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 44
BseXI GCAGC 5 cut(s) 28, 35, 112, 128, 136
BsgI GTGCAG 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 44
BspACI CCGC 2 cut(s) 119, 167
BstC8I GCNNGC 1 cut(s) 46
BstHHI GCGC 1 cut(s) 154
BstMWI GCNNNNNNNGC 3 cut(s) 38, 122, 125
BstV1I GCAGC 5 cut(s) 28, 35, 112, 128, 136
Cac8I GCNNGC 1 cut(s) 46
CfoI GCGC 1 cut(s) 154
CviAII CATG 1 cut(s) 104
CviJI RGCY 3 cut(s) 48, 125, 149
CviKI_1 RGCY 3 cut(s) 48, 125, 149
EcoT22I ATGCAT 1 cut(s) 105
FaeI CATG 1 cut(s) 107
FaiI YATR 6 cut(s) 12, 14, 69, 101, 105, 175
FatI CATG 1 cut(s) 103
FauNDI CATATG 1 cut(s) 12
Fnu4HI GCNGC 5 cut(s) 42, 49, 117, 126, 150
Fsp4HI GCNGC 5 cut(s) 42, 49, 117, 126, 150
FspI TGCGCA 1 cut(s) 153
GlaI GCGC 1 cut(s) 153
GluI GCNGC 5 cut(s) 42, 49, 117, 126, 150
HhaI GCGC 1 cut(s) 154
Hin1II CATG 1 cut(s) 107
Hin6I GCGC 1 cut(s) 152
HinP1I GCGC 1 cut(s) 152
HpyAV CCTTC 2 cut(s) 13, 85
HpyCH4V TGCA 2 cut(s) 51, 103
HpyF10VI GCNNNNNNNGC 3 cut(s) 38, 122, 125
Hsp92II CATG 1 cut(s) 107
HspAI GCGC 1 cut(s) 152
LpnPI CCDG 3 cut(s) 30, 51, 114
Lsp1109I GCAGC 5 cut(s) 28, 35, 112, 128, 136
LweI GCATC 1 cut(s) 19
MluCI AATT 1 cut(s) 170
MnlI CCTC 1 cut(s) 89
Mph1103I ATGCAT 1 cut(s) 105
MspA1I CMGCKG 1 cut(s) 119
MwoI GCNNNNNNNGC 3 cut(s) 38, 122, 125
NdeI CATATG 1 cut(s) 12
NlaIII CATG 1 cut(s) 107
NsbI TGCGCA 1 cut(s) 153
NsiI ATGCAT 1 cut(s) 105
PkrI GCNGC 5 cut(s) 43, 50, 118, 127, 151
SatI GCNGC 5 cut(s) 42, 49, 117, 126, 150
SetI ASST 2 cut(s) 127, 151
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 5 cut(s) 50, 57, 94, 116, 141
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 1 cut(s) 170
SsiI CCGC 2 cut(s) 119, 167
TasI AATT 1 cut(s) 170
TseI GCWGC 5 cut(s) 41, 48, 116, 125, 149
TspDTI ATGAA 1 cut(s) 120
Zsp2I ATGCAT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.