Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003634.1

Orthogroup ID

OG0002438

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 3101

Gene Structure 3101 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003634.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 350 bp

atggctctgcagatggtgaaggagttagatgctattccagctgctagctgcacaatagaaaatgattctgtgtccctcaagcagattgtttatcctatatatgaaacattggcagcggaagctgctagaaacaataacgggaaagctgcacattcagcatggcggaattatgacaactgcaatgaatacttttgctttgtttgcttatcacctgcttgtttagttgagctgacctatgaggagggattcagcttttttgctgaagccttaaaagaggaaaagggtagtttggatgtgttggtcatgtttggggcatataccacagcgagaggcgtggctatctcagactt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005886 GO:0005911 GO:0007049 GO:0007275 GO:0008150 GO:0009506 GO:0009555 GO:0009556 GO:0009987 GO:0012505 GO:0016020 GO:0019953 GO:0022402 GO:0022414 GO:0030054 GO:0032501 GO:0032502 GO:0034293 GO:0040007 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043934 GO:0044424 GO:0044444 GO:0044464 GO:0044703 GO:0048229 GO:0048236 GO:0048589 GO:0048856 GO:0048869 GO:0051321 GO:0051704 GO:0055044 GO:0071944 GO:1903046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FKS1_dom1 Glucan_synthase

Protein Analysis

116

Amino Acids

12.75

Weight (kDa)

4.5

Isoelectric Point (pI)

41.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002438)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36850
fragaria_vesca	FvH4_5g07240
malus_domestica	MD06G1158200.v1.1 MD14G1164600.v1.1 MD14G1164700.v1.1 MD14G1164800.v1.1
prunus_persica	Prupe.5G158100_v2.0.a1 Prupe.5G158100_v2.0.a1 Prupe.5G181200_v2.0.a1
pyrus_communis	pycom06g14110 pycom06g14120 pycom06g14130 pycom14g13740
rosa_chinensis	RchiOBHm_Chr3g0493651 RchiOBHm_Chr7g0191411 RchiOBHm_Chr7g0191641
rosa_laevigata	RLG00000004437 RLG00000004438 RLG00000004457
rosa_multiflora	Rmu_sc0001123.1_g000007 Rmu_sc0002661.1_g000007 Rmu_sc0003634.1_g000001 Rmu_sc0003634.1_g000002
rosa_roxburghii	Rroxscaffold_157G00438350 Rroxscaffold_157G00438470 Rroxscaffold_2G00133560 Rroxscaffold_3G00263680 Rroxscaffold_3G00263840
rosa_rugosa	Rorug06G0510400 Rorug06G0510600
rosa_samantha	Rh7AG118000 Rh7AG119400 Rh7AG119500 Rh7BG120100 Rh7BG121600 Rh7BG121700 Rh7CG122900 Rh7CG124400 Rh7DG121000 Rh7DG122500
rosa_wichuraiana	Rw7G010190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	220
Acc36I	ACCTGC	1 cut(s)	220
AciI	CCGC	2 cut(s)	116, 163
AcuI	CTGAAG	1 cut(s)	282
AluBI	AGCT	6 cut(s)	41, 48, 122, 146, 229, 252
AluI	AGCT	6 cut(s)	41, 48, 122, 146, 229, 252
ApeKI	GCWGC	5 cut(s)	41, 48, 113, 122, 146
AsuHPI	GGTGA	2 cut(s)	28, 201
AsuNHI	GCTAGC	1 cut(s)	44
BbvI	GCAGC	5 cut(s)	28, 35, 109, 125, 133
BccI	CCATC	1 cut(s)	7
BfaI	CTAG	2 cut(s)	45, 126
BfmI	CTRYAG	1 cut(s)	8
BfuAI	ACCTGC	1 cut(s)	220
BisI	GCNGC	5 cut(s)	42, 49, 114, 123, 147
BlsI	GCNGC	5 cut(s)	43, 50, 115, 124, 148
BmsI	GCATC	1 cut(s)	19
BmtI	GCTAGC	1 cut(s)	48
BpuEI	CTTGAG	1 cut(s)	62
Bse3DI	GCAATG	1 cut(s)	187
BseGI	GGATG	1 cut(s)	298
BseMI	GCAATG	1 cut(s)	187
BseRI	GAGGAG	1 cut(s)	254
BseXI	GCAGC	5 cut(s)	28, 35, 109, 125, 133
BsgI	GTGCAG	2 cut(s)	34, 132
BslFI	GGGAC	1 cut(s)	58
BsmFI	GGGAC	1 cut(s)	58
BspACI	CCGC	2 cut(s)	116, 163
BspMAI	CTGCAG	1 cut(s)	12
BspMI	ACCTGC	1 cut(s)	220
BspOI	GCTAGC	1 cut(s)	48
BsrDI	GCAATG	1 cut(s)	187
BstC8I	GCNNGC	1 cut(s)	46
BstDEI	CTNAG	1 cut(s)	343
BstF5I	GGATG	1 cut(s)	298
BstMWI	GCNNNNNNNGC	5 cut(s)	38, 119, 122, 155, 201
BstSFI	CTRYAG	1 cut(s)	8
BstV1I	GCAGC	5 cut(s)	28, 35, 109, 125, 133
BtsCI	GGATG	1 cut(s)	298
BveI	ACCTGC	1 cut(s)	220
Cac8I	GCNNGC	1 cut(s)	46
CviAII	CATG	2 cut(s)	159, 304
CviJI	RGCY	9 cut(s)	5, 41, 48, 122, 146, 229, 252, 266, 338
CviKI_1	RGCY	9 cut(s)	5, 41, 48, 122, 146, 229, 252, 266, 338
DdeI	CTNAG	1 cut(s)	343
EciI	GGCGGA	1 cut(s)	178
Eco57I	CTGAAG	1 cut(s)	282
FaeI	CATG	2 cut(s)	162, 307
FaiI	YATR	9 cut(s)	98, 100, 102, 160, 171, 237, 305, 316, 318
FaqI	GGGAC	1 cut(s)	58
FatI	CATG	2 cut(s)	158, 303
Fnu4HI	GCNGC	5 cut(s)	42, 49, 114, 123, 147
FokI	GGATG	1 cut(s)	305
Fsp4HI	GCNGC	5 cut(s)	42, 49, 114, 123, 147
FspBI	CTAG	2 cut(s)	45, 126
GluI	GCNGC	5 cut(s)	42, 49, 114, 123, 147
Hin1II	CATG	2 cut(s)	162, 307
HinfI	GANTC	2 cut(s)	65, 246
HphI	GGTGA	2 cut(s)	28, 201
Hpy188I	TCNGA	1 cut(s)	346
HpyAV	CCTTC	1 cut(s)	13
HpyCH4V	TGCA	4 cut(s)	10, 51, 149, 180
HpyF10VI	GCNNNNNNNGC	5 cut(s)	38, 119, 122, 155, 201
HpyF3I	CTNAG	1 cut(s)	343
Hsp92II	CATG	2 cut(s)	162, 307
LpnPI	CCDG	2 cut(s)	51, 225
Lsp1109I	GCAGC	5 cut(s)	28, 35, 109, 125, 133
LweI	GCATC	1 cut(s)	19
MaeI	CTAG	2 cut(s)	45, 126
MluCI	AATT	1 cut(s)	166
MnlI	CCTC	5 cut(s)	86, 232, 235, 268, 323
MseI	TTAA	1 cut(s)	269
MspA1I	CMGCKG	2 cut(s)	41, 116
MwoI	GCNNNNNNNGC	5 cut(s)	38, 119, 122, 155, 201
NheI	GCTAGC	1 cut(s)	44
NlaIII	CATG	2 cut(s)	162, 307
PaqCI	CACCTGC	1 cut(s)	220
PfeI	GAWTC	2 cut(s)	65, 246
PkrI	GCNGC	5 cut(s)	43, 50, 115, 124, 148
PstI	CTGCAG	1 cut(s)	12
PvuII	CAGCTG	1 cut(s)	41
SaqAI	TTAA	1 cut(s)	269
SatI	GCNGC	5 cut(s)	42, 49, 114, 123, 147
SetI	ASST	8 cut(s)	43, 50, 124, 148, 214, 231, 236, 254
SfaNI	GCATC	1 cut(s)	19
SfcI	CTRYAG	1 cut(s)	8
SmlI	CTYRAG	1 cut(s)	77
SmoI	CTYRAG	1 cut(s)	77
Sse9I	AATT	1 cut(s)	166
SsiI	CCGC	2 cut(s)	116, 163
SspMI	CTAG	2 cut(s)	45, 126
TasI	AATT	1 cut(s)	166
TfiI	GAWTC	2 cut(s)	65, 246
Tru1I	TTAA	1 cut(s)	269
Tru9I	TTAA	1 cut(s)	269
TseI	GCWGC	5 cut(s)	41, 48, 113, 122, 146
TspDTI	ATGAA	2 cut(s)	117, 198
XspI	CTAG	2 cut(s)	45, 126

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.