Rh7AG119400

Programmed cell death protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0002438
Physical Location & Seq
Forward (+)
9374714 .. 9377193
2480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG119400.1

Sequence Viewer

Length: 201 bp
ATGACAAAAGGCTTTAGCCGGATTAAGGACAAGCTAGATGACTTGGCTCTCGACATTCCAACTGCAAGTGAGAAATTCAGCTTCTATGTGGAGCATGCACAGGAGAAGGGTTGGCAAAAACTTGCGAGAAGGGATGGGAGTCAAATAGATCGCAATCGTGATATTGAGCACCTCTGGGAATTTTACTGGCGCTACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05205 ko05206 map05205 map05206
Pfam Domains
Protein Families
MA3

Protein Analysis

66

Amino Acids

8.06

Weight (kDa)

8.03

Isoelectric Point (pI)

39.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MA3 PF02847 1 - 39 2e-06 MA3 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 74, 179
AfiI CCNNNNNNNGG 1 cut(s) 25
AluBI AGCT 2 cut(s) 34, 81
AluI AGCT 2 cut(s) 34, 81
Alw21I GWGCWC 1 cut(s) 171
ApoI RAATTY 2 cut(s) 74, 179
AspLEI GCGC 1 cut(s) 192
Bbv12I GWGCWC 1 cut(s) 171
BccI CCATC 1 cut(s) 128
BfaI CTAG 1 cut(s) 35
BfoI RGCGCY 1 cut(s) 193
BsaBI GATNNNNATC 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 191
Bse8I GATNNNNATC 1 cut(s) 153
BseGI GGATG 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 25
BseNI ACTGG 1 cut(s) 191
BsiHKAI GWGCWC 1 cut(s) 171
BsiSI CCGG 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 148
BsrI ACTGG 1 cut(s) 191
BssMI GATC 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 96
BstF5I GGATG 1 cut(s) 139
BstH2I RGCGCY 1 cut(s) 193
BstHHI GCGC 1 cut(s) 192
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 98
BtsCI GGATG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 96
CfoI GCGC 1 cut(s) 192
CviAII CATG 1 cut(s) 95
CviJI RGCY 5 cut(s) 12, 18, 34, 47, 81
CviKI_1 RGCY 5 cut(s) 12, 18, 34, 47, 81
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
FaeI CATG 1 cut(s) 98
FaiI YATR 2 cut(s) 87, 96
FatI CATG 1 cut(s) 94
FokI GGATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 35
GlaI GCGC 1 cut(s) 191
HaeII RGCGCY 1 cut(s) 193
HapII CCGG 1 cut(s) 19
HhaI GCGC 1 cut(s) 192
Hin1II CATG 1 cut(s) 98
Hin6I GCGC 1 cut(s) 190
HinP1I GCGC 1 cut(s) 190
HinfI GANTC 1 cut(s) 139
HpaII CCGG 1 cut(s) 19
Hpy188III TCNNGA 2 cut(s) 50, 158
HpyAV CCTTC 2 cut(s) 100, 123
HpyCH4V TGCA 2 cut(s) 65, 98
Hsp92II CATG 1 cut(s) 98
HspAI GCGC 1 cut(s) 190
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 4 cut(s) 32, 86, 160, 172
MaeI CTAG 1 cut(s) 35
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 171
MluCI AATT 2 cut(s) 74, 179
MlyI GAGTC 1 cut(s) 148
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 1 cut(s) 182
MseI TTAA 1 cut(s) 24
MspI CCGG 1 cut(s) 19
NdeII GATC 1 cut(s) 148
NlaIII CATG 1 cut(s) 98
NspI RCATGY 1 cut(s) 98
PaeI GCATGC 1 cut(s) 98
PleI GAGTC 1 cut(s) 147
PpsI GAGTC 1 cut(s) 147
SaqAI TTAA 1 cut(s) 24
Sau3AI GATC 1 cut(s) 148
SchI GAGTC 1 cut(s) 148
SduI GDGCHC 1 cut(s) 171
SetI ASST 3 cut(s) 36, 83, 174
SphI GCATGC 1 cut(s) 98
Sse9I AATT 2 cut(s) 74, 179
SspMI CTAG 1 cut(s) 35
TaqI TCGA 1 cut(s) 51
TasI AATT 2 cut(s) 74, 179
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
XapI RAATTY 2 cut(s) 74, 179
XceI RCATGY 1 cut(s) 98
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.