RchiOBHm_Chr4g0386381

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
1879852 .. 1884765
4914 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35974

Sequence Viewer

Length: 150 bp
ATGGCAACCTTAGCACATTTTCCTACTCCGGCTAGAAGAAAGCGAGCTAGACAAGGAATGAGGATCGACAGCCTGATCAAACGAACTCCAAATGAGTTGAAACTTTCCAGATCGATTCTAGACATCCTAAGGATCATTTCTTATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.73

Weight (kDa)

11.55

Isoelectric Point (pI)

65.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 71, 140
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AlwI GGATC 2 cut(s) 71, 140
AxyI CCTNAGG 1 cut(s) 128
BclI TGATCA 1 cut(s) 75
BfaI CTAG 3 cut(s) 33, 48, 119
Bpu10I CCTNAGC 1 cut(s) 10
Bsa29I ATCGAT 1 cut(s) 113
Bse21I CCTNAGG 1 cut(s) 128
BseCI ATCGAT 1 cut(s) 113
BseGI GGATG 1 cut(s) 123
BshVI ATCGAT 1 cut(s) 113
BsiSI CCGG 1 cut(s) 29
Bsp143I GATC 4 cut(s) 63, 75, 110, 132
BspDI ATCGAT 1 cut(s) 113
BspPI GGATC 2 cut(s) 71, 140
BssMI GATC 4 cut(s) 63, 75, 110, 132
BstC8I GCNNGC 1 cut(s) 45
BstDEI CTNAG 2 cut(s) 10, 128
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 4 cut(s) 66, 78, 113, 135
BstMBI GATC 4 cut(s) 63, 75, 110, 132
BstMWI GCNNNNNNNGC 1 cut(s) 11
Bsu15I ATCGAT 1 cut(s) 113
Bsu36I CCTNAGG 1 cut(s) 128
BsuTUI ATCGAT 1 cut(s) 113
BtsCI GGATG 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 45
ClaI ATCGAT 1 cut(s) 113
CviJI RGCY 3 cut(s) 32, 47, 72
CviKI_1 RGCY 3 cut(s) 32, 47, 72
DdeI CTNAG 2 cut(s) 10, 128
DpnI GATC 4 cut(s) 65, 77, 112, 134
DpnII GATC 4 cut(s) 63, 75, 110, 132
Eco81I CCTNAGG 1 cut(s) 128
FaiI YATR 1 cut(s) 144
FbaI TGATCA 1 cut(s) 75
FokI GGATG 1 cut(s) 110
FspBI CTAG 3 cut(s) 33, 48, 119
HapII CCGG 1 cut(s) 29
HinfI GANTC 1 cut(s) 115
HpaII CCGG 1 cut(s) 29
Hpy188III TCNNGA 2 cut(s) 108, 119
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 2 cut(s) 10, 128
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 4 cut(s) 63, 75, 110, 132
LpnPI CCDG 3 cut(s) 42, 86, 121
MaeI CTAG 3 cut(s) 33, 48, 119
MalI GATC 4 cut(s) 65, 77, 112, 134
MboI GATC 4 cut(s) 63, 75, 110, 132
MboII GAAGA 1 cut(s) 48
MnlI CCTC 1 cut(s) 54
MspI CCGG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 4 cut(s) 63, 75, 110, 132
PfeI GAWTC 1 cut(s) 115
Sau3AI GATC 4 cut(s) 63, 75, 110, 132
SetI ASST 2 cut(s) 11, 49
SgeI CNNG 8 cut(s) 41, 45, 56, 60, 65, 85, 120, 131
SspMI CTAG 3 cut(s) 33, 48, 119
TaqI TCGA 2 cut(s) 66, 113
TfiI GAWTC 1 cut(s) 115
XbaI TCTAGA 1 cut(s) 118
XspI CTAG 3 cut(s) 33, 48, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.