Rroxscaffold_6G00388140

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
877475 .. 877893
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00388140.1

Sequence Viewer

Length: 183 bp
ATGCAGAGGCGTCGGCGGAGAGAGAGACGGAGCTTGGGGATGGGATTGGAAGTGGGATCGAGCTTGAGGGTAGGATATGGATCGAAGAAGGATTTGAATTTGGGGGCGGAGGAGGAAGATTTGATGATAAAGGAGCCCAACCCTAAGAGAATGCATATGACTGACGATAAAGCAGAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.97

Weight (kDa)

9.69

Isoelectric Point (pI)

91.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 16, 107
AclWI GGATC 2 cut(s) 64, 88
AcsI RAATTY 1 cut(s) 97
AcyI GRCGYC 1 cut(s) 10
AgsI TTSAA 1 cut(s) 97
AluBI AGCT 2 cut(s) 33, 63
AluI AGCT 2 cut(s) 33, 63
Alw26I GTCTC 1 cut(s) 19
AlwI GGATC 2 cut(s) 64, 88
ApoI RAATTY 1 cut(s) 97
BanII GRGCYC 1 cut(s) 138
BccI CCATC 1 cut(s) 34
BcgI CGANNNNNNTGC 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 19
BmiI GGNNCC 1 cut(s) 135
BpuEI CTTGAG 1 cut(s) 85
BsaBI GATNNNNATC 1 cut(s) 79
BsaHI GRCGYC 1 cut(s) 10
Bse8I GATNNNNATC 1 cut(s) 79
BseGI GGATG 1 cut(s) 45
BseJI GATNNNNATC 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 19
BsmBI CGTCTC 1 cut(s) 19
BsmI GAATGC 1 cut(s) 156
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 2 cut(s) 56, 80
BspACI CCGC 2 cut(s) 16, 107
BspLI GGNNCC 1 cut(s) 135
BspPI GGATC 2 cut(s) 64, 88
BssMI GATC 2 cut(s) 56, 80
BssNI GRCGYC 1 cut(s) 10
BstACI GRCGYC 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 144
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 2 cut(s) 59, 83
BstMAI GTCTC 1 cut(s) 19
BstMBI GATC 2 cut(s) 56, 80
BtsCI GGATG 1 cut(s) 45
CviJI RGCY 3 cut(s) 33, 63, 136
CviKI_1 RGCY 3 cut(s) 33, 63, 136
DdeI CTNAG 1 cut(s) 144
DpnI GATC 2 cut(s) 58, 82
DpnII GATC 2 cut(s) 56, 80
EciI GGCGGA 2 cut(s) 31, 122
Eco24I GRGCYC 1 cut(s) 138
EcoT22I ATGCAT 1 cut(s) 156
EcoT38I GRGCYC 1 cut(s) 138
Esp3I CGTCTC 1 cut(s) 19
FaiI YATR 3 cut(s) 78, 156, 158
FauNDI CATATG 1 cut(s) 156
FokI GGATG 1 cut(s) 52
FriOI GRGCYC 1 cut(s) 138
Hin1I GRCGYC 1 cut(s) 10
Hpy99I CGWCG 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 82
HpyCH4V TGCA 2 cut(s) 4, 154
HpyF3I CTNAG 1 cut(s) 144
Hsp92I GRCGYC 1 cut(s) 10
Kzo9I GATC 2 cut(s) 56, 80
LmnI GCTCC 2 cut(s) 30, 133
MalI GATC 2 cut(s) 58, 82
MboI GATC 2 cut(s) 56, 80
MboII GAAGA 2 cut(s) 97, 128
MhlI GDGCHC 1 cut(s) 138
MluCI AATT 2 cut(s) 97, 178
MnlI CCTC 3 cut(s) 60, 103, 106
Mph1103I ATGCAT 1 cut(s) 156
Mva1269I GAATGC 1 cut(s) 156
NdeI CATATG 1 cut(s) 156
NdeII GATC 2 cut(s) 56, 80
NlaIV GGNNCC 1 cut(s) 135
NsiI ATGCAT 1 cut(s) 156
PctI GAATGC 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 135
Sau3AI GATC 2 cut(s) 56, 80
SduI GDGCHC 1 cut(s) 138
SetI ASST 2 cut(s) 35, 65
SgeI CNNG 3 cut(s) 46, 72, 76
SmlI CTYRAG 1 cut(s) 64
SmoI CTYRAG 1 cut(s) 64
Sse9I AATT 2 cut(s) 97, 178
SsiI CCGC 2 cut(s) 16, 107
TaqI TCGA 2 cut(s) 59, 83
TasI AATT 2 cut(s) 97, 178
TspGWI ACGGA 1 cut(s) 43
XapI RAATTY 1 cut(s) 97
Zsp2I ATGCAT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.