Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5D

Orthogroup ID

OG0003075

Physical Location & Seq

Genomic Coordinates Reverse (-)

53129826 .. 53138270

Gene Structure 8445 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5DG357400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

ATGGAGAGGGAACCTAAAAGATTGGGGACCACTCTAGGATCAGACAATGAGGAATCGTGCACAACTTATAGCATGCTGAAGATTGGATATTCATATTATGTTTGGATAGAATGGTGGTTGCAAAACTCTTCTTGTTCTCTTCGATTTACTATGTACTCTTTGCCTAGAAAAAGTGTTGGACTTCCAACAATTGATGACTTACTATATCAGGACCATAAGTTTTATAATTATGATGATACCCAATCAAATTTGTTTAATGTTTATGGAAATTTGTACACGTATGCGACCTCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AbfB Glyco_hydro_127

Protein Analysis

97

Amino Acids

11.49

Weight (kDa)

4.9

Isoelectric Point (pI)

56.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003075)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0163901 RchiOBHm_Chr4g0386381 RchiOBHm_Chr5g0025761 RchiOBHm_Chr6g0278061
rosa_laevigata	RLG00000004168 RLG00000013261 RLG00000018556 RLG00000034045
rosa_multiflora	Rmu_sc0005580.1_g000006 Rmu_sc0005879.1_g000016
rosa_roxburghii	Rroxscaffold_2G00106940 Rroxscaffold_2G00112330 Rroxscaffold_3G00218660 Rroxscaffold_3G00241480 Rroxscaffold_4G00322650 Rroxscaffold_5G00342530 Rroxscaffold_6G00388140 Rroxscaffold_6G00388150
rosa_rugosa	Rorug03G0319600
rosa_samantha	Rh2AG389600 Rh2CG222000 Rh2CG376800 Rh2CG549900 Rh3BG348400 Rh4DG151500 Rh5AG180300 Rh5AG508200 Rh5BG295200 Rh5CG196800 Rh5DG178700 Rh5DG305000 Rh5DG357400 Rh6AG172600 Rh7AG471900 Rh7AG472000 Rh7DG351500 Rh7DG450400
rosa_wichuraiana	Rw3G027200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	225
AclWI	GGATC	1 cut(s)	46
AcsI	RAATTY	2 cut(s)	247, 268
AcuI	CTGAAG	1 cut(s)	98
AfaI	GTAC	2 cut(s)	155, 275
AflIII	ACRYGT	1 cut(s)	276
Alw21I	GWGCWC	1 cut(s)	62
Alw44I	GTGCAC	1 cut(s)	58
AlwI	GGATC	1 cut(s)	46
ApaLI	GTGCAC	1 cut(s)	58
ApoI	RAATTY	2 cut(s)	247, 268
AspS9I	GGNCC	2 cut(s)	27, 211
AvaII	GGWCC	2 cut(s)	27, 211
BaeGI	GKGCMC	1 cut(s)	62
Bbv12I	GWGCWC	1 cut(s)	62
BfaI	CTAG	2 cut(s)	35, 165
Bme18I	GGWCC	2 cut(s)	27, 211
BmgT120I	GGNCC	2 cut(s)	27, 211
BmiI	GGNNCC	2 cut(s)	12, 28
BsaAI	YACGTR	1 cut(s)	279
BseSI	GKGCMC	1 cut(s)	62
BsiHKAI	GWGCWC	1 cut(s)	62
BslFI	GGGAC	1 cut(s)	40
BsmFI	GGGAC	1 cut(s)	40
Bsp1286I	GDGCHC	1 cut(s)	62
Bsp1407I	TGTACA	1 cut(s)	273
Bsp143I	GATC	1 cut(s)	38
BspLI	GGNNCC	2 cut(s)	12, 28
BspPI	GGATC	1 cut(s)	46
BsrGI	TGTACA	1 cut(s)	273
BssMI	GATC	1 cut(s)	38
Bst6I	CTCTTC	2 cut(s)	133, 144
BstAUI	TGTACA	1 cut(s)	273
BstBAI	YACGTR	1 cut(s)	279
BstC8I	GCNNGC	1 cut(s)	74
BstKTI	GATC	1 cut(s)	41
BstMBI	GATC	1 cut(s)	38
BstNSI	RCATGY	1 cut(s)	76
BstSLI	GKGCMC	1 cut(s)	62
Cac8I	GCNNGC	1 cut(s)	74
Cfr13I	GGNCC	2 cut(s)	27, 211
Csp6I	GTAC	2 cut(s)	154, 274
CviAII	CATG	1 cut(s)	73
CviQI	GTAC	2 cut(s)	154, 274
DpnI	GATC	1 cut(s)	40
DpnII	GATC	1 cut(s)	38
Eam1104I	CTCTTC	2 cut(s)	133, 144
EarI	CTCTTC	2 cut(s)	133, 144
Eco47I	GGWCC	2 cut(s)	27, 211
Eco57I	CTGAAG	1 cut(s)	98
FaeI	CATG	1 cut(s)	76
FaqI	GGGAC	1 cut(s)	40
FatI	CATG	1 cut(s)	72
FspBI	CTAG	2 cut(s)	35, 165
Hin1II	CATG	1 cut(s)	76
HinfI	GANTC	1 cut(s)	53
Hpy166II	GTNNAC	2 cut(s)	60, 276
Hpy188I	TCNGA	1 cut(s)	43
Hpy188III	TCNNGA	2 cut(s)	209, 291
Hpy8I	GTNNAC	2 cut(s)	60, 276
HpyCH4IV	ACGT	1 cut(s)	278
HpyCH4V	TGCA	2 cut(s)	60, 121
HpySE526I	ACGT	1 cut(s)	278
Hsp92II	CATG	1 cut(s)	76
Kzo9I	GATC	1 cut(s)	38
LpnPI	CCDG	1 cut(s)	194
MaeI	CTAG	2 cut(s)	35, 165
MaeII	ACGT	1 cut(s)	278
MalI	GATC	1 cut(s)	40
MboI	GATC	1 cut(s)	38
MboII	GAAGA	3 cut(s)	91, 120, 131
MfeI	CAATTG	1 cut(s)	189
MhlI	GDGCHC	1 cut(s)	62
MluCI	AATT	4 cut(s)	189, 226, 247, 268
MmeI	TCCRAC	2 cut(s)	157, 209
MnlI	CCTC	1 cut(s)	43
MseI	TTAA	1 cut(s)	255
MunI	CAATTG	1 cut(s)	189
NdeII	GATC	1 cut(s)	38
NlaIII	CATG	1 cut(s)	76
NlaIV	GGNNCC	2 cut(s)	12, 28
NspI	RCATGY	1 cut(s)	76
PaeI	GCATGC	1 cut(s)	76
PfeI	GAWTC	1 cut(s)	53
Ppu21I	YACGTR	1 cut(s)	279
PsiI	TTATAA	1 cut(s)	225
PspN4I	GGNNCC	2 cut(s)	12, 28
PspPI	GGNCC	2 cut(s)	27, 211
RsaI	GTAC	2 cut(s)	155, 275
RsaNI	GTAC	2 cut(s)	154, 274
SaqAI	TTAA	1 cut(s)	255
Sau3AI	GATC	1 cut(s)	38
Sau96I	GGNCC	2 cut(s)	27, 211
SduI	GDGCHC	1 cut(s)	62
SetI	ASST	3 cut(s)	16, 281, 290
SgeI	CNNG	7 cut(s)	47, 69, 85, 144, 177, 221, 289
SinI	GGWCC	2 cut(s)	27, 211
SphI	GCATGC	1 cut(s)	76
Sse9I	AATT	4 cut(s)	189, 226, 247, 268
SspMI	CTAG	2 cut(s)	35, 165
TaiI	ACGT	1 cut(s)	281
TaqI	TCGA	1 cut(s)	142
TasI	AATT	4 cut(s)	189, 226, 247, 268
TatI	WGTACW	2 cut(s)	153, 273
TfiI	GAWTC	1 cut(s)	53
Tru1I	TTAA	1 cut(s)	255
Tru9I	TTAA	1 cut(s)	255
TspDTI	ATGAA	1 cut(s)	81
VneI	GTGCAC	1 cut(s)	58
VpaK11BI	GGWCC	2 cut(s)	27, 211
XapI	RAATTY	2 cut(s)	247, 268
XceI	RCATGY	1 cut(s)	76
XspI	CTAG	2 cut(s)	35, 165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.