Rh7AG472000

Removes the formyl group from the N-terminal Met of newly synthesized proteins

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
65487396 .. 65488203
808 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG472000.1

Sequence Viewer

Length: 168 bp
ATGGTGAAGGTGATGAGGAAGGCTCCTGGGGTTGGTCTTGCTGCTCCACAGATTGGAGTTCCCTTAAGGATAATAGTCTTGGAAGATACAAAGGAATATATTAGTTATGCACCCAAGGATGAGATTAAAGTTCAAGAGAGACGGCCTTTCGATCTTTTGGTATGTTAA

Protein Analysis

55

Amino Acids

6.2

Weight (kDa)

8.93

Isoelectric Point (pI)

52.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pep_deformylase PF01327 1 - 37 3.5e-09 Polypeptide deformylase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AfiI CCNNNNNNNGG 2 cut(s) 32, 53
AflII CTTAAG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 25
Alw26I GTCTC 1 cut(s) 133
AoxI GGCC 1 cut(s) 143
ApeKI GCWGC 1 cut(s) 41
AsuHPI GGTGA 2 cut(s) 16, 22
BbvI GCAGC 1 cut(s) 28
BceAI ACGGC 1 cut(s) 158
BciT130I CCWGG 1 cut(s) 27
BcoDI GTCTC 1 cut(s) 133
BfrI CTTAAG 1 cut(s) 64
BisI GCNGC 1 cut(s) 42
BlsI GCNGC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 27
BmiI GGNNCC 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 27
BplI GAGNNNNNCTC 2 cut(s) 7, 39
BsaJI CCNNGG 2 cut(s) 26, 114
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 53
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 2 cut(s) 26, 114
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 2 cut(s) 32, 53
BseXI GCAGC 1 cut(s) 28
BshFI GGCC 1 cut(s) 145
BslI CCNNNNNNNGG 2 cut(s) 32, 53
BsmAI GTCTC 1 cut(s) 133
BsmBI CGTCTC 1 cut(s) 133
BsnI GGCC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 151
BspANI GGCC 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 24
BspTI CTTAAG 1 cut(s) 64
BssECI CCNNGG 2 cut(s) 26, 114
BssMI GATC 1 cut(s) 151
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 27
BstAFI CTTAAG 1 cut(s) 64
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 1 cut(s) 154
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BstV1I GCAGC 1 cut(s) 28
BsuRI GGCC 1 cut(s) 145
BtsCI GGATG 1 cut(s) 124
CviJI RGCY 2 cut(s) 23, 145
CviKI_1 RGCY 2 cut(s) 23, 145
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco130I CCWWGG 1 cut(s) 114
EcoRII CCWGG 1 cut(s) 25
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
Esp3I CGTCTC 1 cut(s) 133
FaiI YATR 3 cut(s) 99, 108, 163
Fnu4HI GCNGC 1 cut(s) 42
FokI GGATG 1 cut(s) 131
Fsp4HI GCNGC 1 cut(s) 42
GluI GCNGC 1 cut(s) 42
HaeIII GGCC 1 cut(s) 145
HphI GGTGA 2 cut(s) 16, 22
Hpy188III TCNNGA 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 110
Kzo9I GATC 1 cut(s) 151
LmnI GCTCC 2 cut(s) 28, 49
LpnPI CCDG 2 cut(s) 12, 39
Lsp1109I GCAGC 1 cut(s) 28
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MboII GAAGA 1 cut(s) 95
MnlI CCTC 1 cut(s) 9
MseI TTAA 3 cut(s) 65, 126, 166
MspCI CTTAAG 1 cut(s) 64
MspR9I CCNGG 1 cut(s) 27
MvaI CCWGG 1 cut(s) 27
NdeII GATC 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 24
PflMI CCANNNNNTGG 1 cut(s) 53
PkrI GCNGC 1 cut(s) 43
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 24
SaqAI TTAA 3 cut(s) 65, 126, 166
SatI GCNGC 1 cut(s) 42
Sau3AI GATC 1 cut(s) 151
ScrFI CCNGG 1 cut(s) 27
SetI ASST 1 cut(s) 12
SgeI CNNG 6 cut(s) 38, 39, 50, 91, 127, 146
SmlI CTYRAG 1 cut(s) 64
SmoI CTYRAG 1 cut(s) 64
StyD4I CCNGG 1 cut(s) 25
StyI CCWWGG 1 cut(s) 114
TaqI TCGA 1 cut(s) 150
Tru1I TTAA 3 cut(s) 65, 126, 166
Tru9I TTAA 3 cut(s) 65, 126, 166
TseI GCWGC 1 cut(s) 41
Van91I CCANNNNNTGG 1 cut(s) 53
Vha464I CTTAAG 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.