Rh5DG178700

Ring finger

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
19758604 .. 19764688
6085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG178700.1

Sequence Viewer

Length: 273 bp
ATGGGTTTTGGTCGACAGGGAAGAGGATCAAGGTTTCCAGATATCAAAGAGGATGAGCCTGAGGATGATGACATTAATGTACTAGTTAAGTTCTATGATTTCAAAGATTCAGGGAGGGATAGTAAGTCGAATTCACGGGGACCAAAGAGGTGCAAGTATGGAGCTAAGACAAATAGACTGCAGTCCCAAGGGTCGTTGCAAATGGAACACTTAGCTTCTTCGGAAGATCTGATACAATGCTCTGGAGAGGAGAGAAGCTTGCAAGGGCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.17

Weight (kDa)

6.57

Isoelectric Point (pI)

61.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 13
AciI CCGC 1 cut(s) 268
AclWI GGATC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 130
AfaI GTAC 1 cut(s) 81
AgsI TTSAA 1 cut(s) 103
AhlI ACTAGT 1 cut(s) 82
AluBI AGCT 3 cut(s) 164, 215, 258
AluI AGCT 3 cut(s) 164, 215, 258
AlwI GGATC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 130
AseI ATTAAT 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 140
AvaII GGWCC 1 cut(s) 140
AxyI CCTNAGG 1 cut(s) 60
BarI GAAGNNNNNNTAC 2 cut(s) 216, 248
BcuI ACTAGT 1 cut(s) 82
BfaI CTAG 1 cut(s) 83
BfmI CTRYAG 1 cut(s) 179
BglII AGATCT 1 cut(s) 226
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmiI GGNNCC 1 cut(s) 141
BoxI GACNNNNGTC 1 cut(s) 181
BpmI CTGGAG 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 187
BsaXI ACNNNNNCTCC 2 cut(s) 106, 136
Bse21I CCTNAGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 2 cut(s) 58, 70
BseMII CTCAG 1 cut(s) 51
BseRI GAGGAG 1 cut(s) 263
BslFI GGGAC 2 cut(s) 153, 169
BsmFI GGGAC 2 cut(s) 153, 169
Bsp143I GATC 2 cut(s) 26, 226
BspACI CCGC 1 cut(s) 268
BspCNI CTCAG 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 141
BspMAI CTGCAG 1 cut(s) 183
BspPI GGATC 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 2 cut(s) 26, 226
BssT1I CCWWGG 1 cut(s) 187
Bst6I CTCTTC 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 260
BstDEI CTNAG 3 cut(s) 60, 165, 211
BstF5I GGATG 2 cut(s) 58, 70
BstKTI GATC 2 cut(s) 29, 229
BstMBI GATC 2 cut(s) 26, 226
BstPAI GACNNNNGTC 1 cut(s) 181
BstSFI CTRYAG 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
Bsu36I CCTNAGG 1 cut(s) 60
BtsCI GGATG 2 cut(s) 58, 70
Cac8I GCNNGC 1 cut(s) 260
Cfr13I GGNCC 1 cut(s) 140
Csp6I GTAC 1 cut(s) 80
CviJI RGCY 4 cut(s) 58, 164, 215, 258
CviKI_1 RGCY 4 cut(s) 58, 164, 215, 258
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 3 cut(s) 60, 165, 211
DpnI GATC 2 cut(s) 28, 228
DpnII GATC 2 cut(s) 26, 226
Eam1104I CTCTTC 1 cut(s) 16
EarI CTCTTC 1 cut(s) 16
Eco130I CCWWGG 1 cut(s) 187
Eco32I GATATC 1 cut(s) 43
Eco47I GGWCC 1 cut(s) 140
Eco81I CCTNAGG 1 cut(s) 60
EcoRI GAATTC 1 cut(s) 130
EcoRV GATATC 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 187
FaiI YATR 2 cut(s) 96, 159
FaqI GGGAC 2 cut(s) 153, 169
FblI GTMKAC 1 cut(s) 13
FokI GGATG 2 cut(s) 65, 77
FspBI CTAG 1 cut(s) 83
GsuI CTGGAG 1 cut(s) 264
HincII GTYRAC 1 cut(s) 14
HindII GTYRAC 1 cut(s) 14
HindIII AAGCTT 1 cut(s) 256
HinfI GANTC 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 14
Hpy188I TCNGA 2 cut(s) 223, 231
Hpy188III TCNNGA 2 cut(s) 38, 243
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4V TGCA 4 cut(s) 153, 181, 199, 262
HpyF3I CTNAG 3 cut(s) 60, 165, 211
Kzo9I GATC 2 cut(s) 26, 226
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 5 cut(s) 2, 51, 72, 96, 228
MaeI CTAG 1 cut(s) 83
MalI GATC 2 cut(s) 28, 228
MboI GATC 2 cut(s) 26, 226
MboII GAAGA 3 cut(s) 33, 210, 236
MflI RGATCY 1 cut(s) 226
MluCI AATT 1 cut(s) 130
MnlI CCTC 6 cut(s) 17, 43, 55, 108, 141, 241
MseI TTAA 2 cut(s) 75, 87
NdeII GATC 2 cut(s) 26, 226
NlaIV GGNNCC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 107
PshAI GACNNNNGTC 1 cut(s) 181
PshBI ATTAAT 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 141
PspPI GGNCC 1 cut(s) 140
PstI CTGCAG 1 cut(s) 183
PsuI RGATCY 1 cut(s) 226
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SalI GTCGAC 1 cut(s) 12
SaqAI TTAA 2 cut(s) 75, 87
Sau3AI GATC 2 cut(s) 26, 226
Sau96I GGNCC 1 cut(s) 140
SetI ASST 5 cut(s) 35, 152, 166, 217, 260
SfcI CTRYAG 1 cut(s) 179
SinI GGWCC 1 cut(s) 140
SpeI ACTAGT 1 cut(s) 82
Sse9I AATT 1 cut(s) 130
SsiI CCGC 1 cut(s) 268
SspMI CTAG 1 cut(s) 83
StyI CCWWGG 1 cut(s) 187
TaqI TCGA 2 cut(s) 13, 128
TasI AATT 1 cut(s) 130
TatI WGTACW 1 cut(s) 79
TfiI GAWTC 1 cut(s) 107
Tru1I TTAA 2 cut(s) 75, 87
Tru9I TTAA 2 cut(s) 75, 87
VpaK11BI GGWCC 1 cut(s) 140
VspI ATTAAT 1 cut(s) 75
XapI RAATTY 1 cut(s) 130
XmiI GTMKAC 1 cut(s) 13
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.