RchiOBHm_Chr4g0388121

RNA polymerase III

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
3294160 .. 3299478
5319 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36138

Sequence Viewer

Length: 264 bp
ATGTATGCTGTTCTTAATTATATATCAGTTATGGTGGTGAAGATAGTGGTCATCAGCAGTATTTTATCTGGGATATCAGCTGTGAGGAGGTTCATACCAAAAGCTTGCCCAAAGGCTGAAGTTAAACCCGACCTGGAGGAGGAAGAGCAAGCTAGTCATGCTGAAAAGGAGAGGGAGTTGCTCAGACATTTCCATGAACAATCTTTGAGGGCAAAGCTGAAAAACGAAAAGAAAGGTAGAGGCTTTTCTCAAGTGGGTTTTTGA

Protein Analysis

87

Amino Acids

9.9

Weight (kDa)

9.41

Isoelectric Point (pI)

50.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 139
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 4 cut(s) 80, 104, 152, 217
AluI AGCT 4 cut(s) 80, 104, 152, 217
AsuHPI GGTGA 1 cut(s) 49
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 234
BsaXI ACNNNNNCTCC 2 cut(s) 161, 191
Bsc4I CCNNNNNNNGG 1 cut(s) 139
BseBI CCWGG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 1 cut(s) 196
BseRI GAGGAG 2 cut(s) 100, 152
BslI CCNNNNNNNGG 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 195
BspQI GCTCTTC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 134
Bst6I CTCTTC 1 cut(s) 138
BstC8I GCNNGC 2 cut(s) 106, 150
BstDEI CTNAG 1 cut(s) 182
BstENI CCTNNNNNAGG 1 cut(s) 137
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
Cac8I GCNNGC 2 cut(s) 106, 150
CviAII CATG 2 cut(s) 158, 194
CviJI RGCY 6 cut(s) 80, 104, 116, 152, 217, 243
CviKI_1 RGCY 6 cut(s) 80, 104, 116, 152, 217, 243
DdeI CTNAG 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco32I GATATC 1 cut(s) 75
Eco57I CTGAAG 1 cut(s) 138
EcoNI CCTNNNNNAGG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 132
EcoRV GATATC 1 cut(s) 75
FaeI CATG 2 cut(s) 161, 197
FaiI YATR 7 cut(s) 6, 21, 23, 32, 95, 159, 195
FatI CATG 2 cut(s) 157, 193
FspBI CTAG 1 cut(s) 153
GsuI CTGGAG 1 cut(s) 155
Hin1II CATG 2 cut(s) 161, 197
HindIII AAGCTT 1 cut(s) 102
HphI GGTGA 1 cut(s) 49
Hpy188I TCNGA 1 cut(s) 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 182
Hsp92II CATG 2 cut(s) 161, 197
LguI GCTCTTC 1 cut(s) 138
LpnPI CCDG 3 cut(s) 54, 119, 146
MaeI CTAG 1 cut(s) 153
MboII GAAGA 2 cut(s) 52, 155
MluCI AATT 1 cut(s) 16
MnlI CCTC 7 cut(s) 78, 81, 130, 133, 165, 201, 233
MseI TTAA 2 cut(s) 15, 123
MslI CAYNNNNRTG 1 cut(s) 192
MspA1I CMGCKG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 158
NlaIII CATG 2 cut(s) 161, 197
PciSI GCTCTTC 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PvuII CAGCTG 1 cut(s) 80
RseI CAYNNNNRTG 1 cut(s) 192
SapI GCTCTTC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 15, 123
ScrFI CCNGG 1 cut(s) 134
SetI ASST 7 cut(s) 82, 92, 106, 135, 154, 219, 238
SgeI CNNG 9 cut(s) 81, 117, 140, 145, 146, 161, 165, 170, 206
SmiMI CAYNNNNRTG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 249
SmoI CTYRAG 1 cut(s) 249
Sse9I AATT 1 cut(s) 16
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 132
TasI AATT 1 cut(s) 16
Tru1I TTAA 2 cut(s) 15, 123
Tru9I TTAA 2 cut(s) 15, 123
TspDTI ATGAA 2 cut(s) 82, 210
XagI CCTNNNNNAGG 1 cut(s) 137
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.