Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000322.1

Orthogroup ID

OG0003703

Physical Location & Seq

Genomic Coordinates Forward (+)

101039 .. 105818

Gene Structure 4780 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000322.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 771 bp

atgggtaactgggatttgaattttgtggtctcagtcttggattcgaacgtacattggagctgtggatttgagattggaggcaaaaatgtcaaaatttgggccaagaaggatcatgtctgggagaaggttttggagagggacttggtgttatttaaaggcaccaaggcgaaacagactaaggatgtcgcttataggatcactgctaaggcctcggatgttgcgcatactatgtatgctgttcttaattatactgttgtacccaatgctctgcagatatcagttatgctggtgaagatagtggtcatcagccgtattttatctaggatttcagctgtgaatgttgtggatatggcgctggcagattcggagtgtaacaagcatgaaaattccgaattgagattgtcatgtttctgtaacaaggctttagtcaatgttggtactgatttggcaaaactagttcctggccgagtgtccactgaggtagatgcacgtcttgcttatgacacgcatggaattataaggaagcttgtcgacagcatgtcggcagatctgccggtccatcagacgacggagtcagctgcaaaccgtcgactcaatgatcgtagaagtcacaccacggcatatttctgtccacagcttgtcgacagcatgtcggcagatctgccggtccatcagacgacggagtcagctgcaaaccgtcaactcaatgatcggtatacgacggttgaaaaccgtcgtctgacagcgtttcatcagacgacgcctcgatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00030 ko01100 ko01110 ko01120 ko01130 ko01200 ko01230 map00030 map01100 map01110 map01120 map01130 map01200 map01230

Pfam Domains

Protein Families

TAL_FSA

Protein Analysis

256

Amino Acids

28.67

Weight (kDa)

8.94

Isoelectric Point (pI)

38.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003703)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0097261 RchiOBHm_Chr4g0388121 RchiOBHm_Chr6g0254981 RchiOBHm_Chr6g0270571
rosa_laevigata	RLG00000013625 RLG00000016400 RLG00000027818 RLG00000028940 RLG00000033711 RLG00000035539 RLG00000035931
rosa_multiflora	Rmu_sc0000322.1_g000027
rosa_roxburghii	Rroxscaffold_1G00026630 Rroxscaffold_5G00347830
rosa_rugosa	Rorug02G0295700 Rorug03G0217900 Rorug04G0030800 Rorug04G0257000 Rorug05G0516900 Rorug06G0100200 Rorug06G0468100
rosa_samantha	Rh1AG155900 Rh1AG219700 Rh1DG187200 Rh2BG424900 Rh4AG076000 Rh4BG015100 Rh4DG099500 Rh7CG342400 Rh7DG317900 Rh7DG373200
rosa_wichuraiana	Rw3G022170 Rw7G027100 Rw7G027110 Rw7G031460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	518
AasI	GACNNNNNNGTC	2 cut(s)	571, 682
Acc16I	TGCGCA	1 cut(s)	222
AccB1I	GGYRCC	1 cut(s)	158
AccI	GTMKAC	4 cut(s)	531, 589, 642, 716
AclWI	GGATC	2 cut(s)	117, 203
AcoI	YGGCCR	1 cut(s)	463
AcsI	RAATTY	3 cut(s)	19, 93, 385
AcyI	GRCGYC	1 cut(s)	761
AfaI	GTAC	3 cut(s)	51, 258, 439
AgsI	TTSAA	2 cut(s)	19, 728
AhdI	GACNNNNNGTC	2 cut(s)	538, 649
AhlI	ACTAGT	1 cut(s)	454
AjiI	CACGTC	1 cut(s)	491
AjnI	CCWGG	1 cut(s)	460
AluBI	AGCT	6 cut(s)	60, 332, 526, 578, 637, 689
AluI	AGCT	6 cut(s)	60, 332, 526, 578, 637, 689
Alw26I	GTCTC	1 cut(s)	34
AlwI	GGATC	2 cut(s)	117, 203
AoxI	GGCC	3 cut(s)	99, 207, 463
ApeKI	GCWGC	2 cut(s)	578, 689
ApoI	RAATTY	3 cut(s)	19, 93, 385
AspLEI	GCGC	2 cut(s)	223, 355
AspS9I	GGNCC	3 cut(s)	99, 556, 667
AsuHPI	GGTGA	1 cut(s)	301
AsuII	TTCGAA	1 cut(s)	44
AvaII	GGWCC	2 cut(s)	556, 667
BaeI	ACNNNNGTAYC	2 cut(s)	240, 273
BanI	GGYRCC	1 cut(s)	158
BbvI	GCAGC	2 cut(s)	565, 676
BccI	CCATC	2 cut(s)	567, 678
BceAI	ACGGC	2 cut(s)	294, 633
BciT130I	CCWGG	1 cut(s)	462
BcoDI	GTCTC	1 cut(s)	34
BcuI	ACTAGT	1 cut(s)	454
BfaI	CTAG	2 cut(s)	321, 455
BfmI	CTRYAG	1 cut(s)	269
BfoI	RGCGCY	1 cut(s)	356
BglII	AGATCT	2 cut(s)	547, 658
BisI	GCNGC	2 cut(s)	579, 690
BlsI	GCNGC	2 cut(s)	580, 691
Bme1390I	CCNGG	1 cut(s)	462
Bme18I	GGWCC	2 cut(s)	556, 667
BmeRI	GACNNNNNGTC	2 cut(s)	538, 649
BmgBI	CACGTC	1 cut(s)	491
BmgT120I	GGNCC	3 cut(s)	99, 556, 667
BmiI	GGNNCC	1 cut(s)	160
BmrFI	CCNGG	1 cut(s)	462
BmrI	ACTGGG	1 cut(s)	19
BmsI	GCATC	1 cut(s)	475
BmuI	ACTGGG	1 cut(s)	19
Bpu10I	CCTNAGC	1 cut(s)	204
Bpu14I	TTCGAA	1 cut(s)	44
BsaHI	GRCGYC	1 cut(s)	761
BsaI	GGTCTC	1 cut(s)	34
BsaJI	CCNNGG	3 cut(s)	162, 210, 615
Bse118I	RCCGGY	2 cut(s)	553, 664
Bse1I	ACTGG	1 cut(s)	14
BseBI	CCWGG	1 cut(s)	462
BseDI	CCNNGG	3 cut(s)	162, 210, 615
BseGI	GGATG	2 cut(s)	187, 220
BseMII	CTCAG	2 cut(s)	45, 468
BseNI	ACTGG	1 cut(s)	14
BseXI	GCAGC	2 cut(s)	565, 676
BshFI	GGCC	3 cut(s)	101, 209, 465
BshNI	GGYRCC	1 cut(s)	158
BsiSI	CCGG	2 cut(s)	554, 665
BslFI	GGGAC	1 cut(s)	152
BsmAI	GTCTC	1 cut(s)	34
BsmFI	GGGAC	1 cut(s)	152
BsnI	GGCC	3 cut(s)	101, 209, 465
Bso31I	GGTCTC	1 cut(s)	34
Bsp119I	TTCGAA	1 cut(s)	44
Bsp143I	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
BspANI	GGCC	3 cut(s)	101, 209, 465
BspCNI	CTCAG	2 cut(s)	44, 469
BspLI	GGNNCC	1 cut(s)	160
BspMAI	CTGCAG	1 cut(s)	273
BspPI	GGATC	2 cut(s)	117, 203
BspT104I	TTCGAA	1 cut(s)	44
BspT107I	GGYRCC	1 cut(s)	158
BspTNI	GGTCTC	1 cut(s)	34
BsrFI	RCCGGY	2 cut(s)	553, 664
BsrI	ACTGG	1 cut(s)	14
BssAI	RCCGGY	2 cut(s)	553, 664
BssECI	CCNNGG	3 cut(s)	162, 210, 615
BssMI	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
BssNAI	GTATAC	1 cut(s)	717
BssNI	GRCGYC	1 cut(s)	761
BssT1I	CCWWGG	1 cut(s)	162
Bst1107I	GTATAC	1 cut(s)	717
Bst2UI	CCWGG	1 cut(s)	462
Bst4CI	ACNGT	5 cut(s)	253, 587, 698, 724, 734
BstACI	GRCGYC	1 cut(s)	761
BstAPI	GCANNNNNTGC	1 cut(s)	494
BstBI	TTCGAA	1 cut(s)	44
BstC8I	GCNNGC	1 cut(s)	357
BstDEI	CTNAG	4 cut(s)	31, 177, 204, 477
BstDSI	CCRYGG	1 cut(s)	615
BstF5I	GGATG	2 cut(s)	187, 220
BstH2I	RGCGCY	1 cut(s)	356
BstHHI	GCGC	2 cut(s)	223, 355
BstKTI	GATC	6 cut(s)	112, 198, 550, 601, 661, 712
BstMAI	GTCTC	1 cut(s)	34
BstMBI	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
BstMWI	GCNNNNNNNGC	1 cut(s)	494
BstNI	CCWGG	1 cut(s)	462
BstNSI	RCATGY	2 cut(s)	541, 652
BstSCI	CCNGG	1 cut(s)	460
BstSFI	CTRYAG	1 cut(s)	269
BstV1I	GCAGC	2 cut(s)	565, 676
BstX2I	RGATCY	2 cut(s)	547, 658
BstYI	RGATCY	2 cut(s)	547, 658
BstZ17I	GTATAC	1 cut(s)	717
BsuRI	GGCC	3 cut(s)	101, 209, 465
BtgI	CCRYGG	1 cut(s)	615
BtrI	CACGTC	1 cut(s)	491
BtsCI	GGATG	2 cut(s)	187, 220
BtsI	GCAGTG	1 cut(s)	198
BtsIMutI	CAGTG	2 cut(s)	198, 474
Cac8I	GCNNGC	1 cut(s)	357
CfoI	GCGC	2 cut(s)	223, 355
Cfr10I	RCCGGY	2 cut(s)	553, 664
Cfr13I	GGNCC	3 cut(s)	99, 556, 667
Csp6I	GTAC	3 cut(s)	50, 257, 438
CviAII	CATG	6 cut(s)	113, 380, 405, 509, 538, 649
CviQI	GTAC	3 cut(s)	50, 257, 438
DdeI	CTNAG	4 cut(s)	31, 177, 204, 477
DpnI	GATC	6 cut(s)	111, 197, 549, 600, 660, 711
DpnII	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
DraI	TTTAAA	1 cut(s)	154
DrdI	GACNNNNNNGTC	2 cut(s)	571, 682
DriI	GACNNNNNGTC	2 cut(s)	538, 649
DseDI	GACNNNNNNGTC	2 cut(s)	571, 682
EaeI	YGGCCR	1 cut(s)	463
Eam1105I	GACNNNNNGTC	2 cut(s)	538, 649
Eco130I	CCWWGG	1 cut(s)	162
Eco147I	AGGCCT	1 cut(s)	209
Eco31I	GGTCTC	1 cut(s)	34
Eco32I	GATATC	1 cut(s)	276
Eco47I	GGWCC	2 cut(s)	556, 667
EcoRII	CCWGG	1 cut(s)	460
EcoRV	GATATC	1 cut(s)	276
EcoT14I	CCWWGG	1 cut(s)	162
ErhI	CCWWGG	1 cut(s)	162
FaeI	CATG	6 cut(s)	116, 383, 408, 512, 541, 652
FaqI	GGGAC	1 cut(s)	152
FatI	CATG	6 cut(s)	112, 379, 404, 508, 537, 648
FblI	GTMKAC	4 cut(s)	531, 589, 642, 716
Fnu4HI	GCNGC	2 cut(s)	579, 690
FokI	GGATG	2 cut(s)	194, 227
Fsp4HI	GCNGC	2 cut(s)	579, 690
FspBI	CTAG	2 cut(s)	321, 455
FspI	TGCGCA	1 cut(s)	222
GlaI	GCGC	2 cut(s)	222, 354
GluI	GCNGC	2 cut(s)	579, 690
HaeII	RGCGCY	1 cut(s)	356
HaeIII	GGCC	3 cut(s)	101, 209, 465
HapII	CCGG	2 cut(s)	554, 665
HhaI	GCGC	2 cut(s)	223, 355
Hin1I	GRCGYC	1 cut(s)	761
Hin1II	CATG	6 cut(s)	116, 383, 408, 512, 541, 652
Hin6I	GCGC	2 cut(s)	221, 353
HinP1I	GCGC	2 cut(s)	221, 353
HincII	GTYRAC	4 cut(s)	532, 590, 643, 701
HindII	GTYRAC	4 cut(s)	532, 590, 643, 701
HindIII	AAGCTT	1 cut(s)	524
HinfI	GANTC	5 cut(s)	41, 362, 572, 591, 683
HpaII	CCGG	2 cut(s)	554, 665
HphI	GGTGA	1 cut(s)	301
Hpy166II	GTNNAC	7 cut(s)	474, 532, 590, 632, 643, 701, 717
Hpy188I	TCNGA	7 cut(s)	214, 367, 391, 564, 675, 741, 756
Hpy8I	GTNNAC	7 cut(s)	474, 532, 590, 632, 643, 701, 717
Hpy99I	CGWCG	6 cut(s)	571, 591, 682, 724, 738, 763
HpyAV	CCTTC	2 cut(s)	100, 118
HpyCH4III	ACNGT	5 cut(s)	253, 587, 698, 724, 734
HpyCH4IV	ACGT	2 cut(s)	48, 490
HpyCH4V	TGCA	4 cut(s)	271, 488, 581, 692
HpyF10VI	GCNNNNNNNGC	1 cut(s)	494
HpyF3I	CTNAG	4 cut(s)	31, 177, 204, 477
HpySE526I	ACGT	2 cut(s)	48, 490
Hsp92I	GRCGYC	1 cut(s)	761
Hsp92II	CATG	6 cut(s)	116, 383, 408, 512, 541, 652
HspAI	GCGC	2 cut(s)	221, 353
Kzo9I	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
LmnI	GCTCC	1 cut(s)	57
LpnPI	CCDG	7 cut(s)	103, 272, 341, 447, 474, 567, 678
Lsp1109I	GCAGC	2 cut(s)	565, 676
LweI	GCATC	1 cut(s)	475
MaeI	CTAG	2 cut(s)	321, 455
MaeII	ACGT	2 cut(s)	48, 490
MaeIII	GTNAC	4 cut(s)	5, 371, 413, 608
MalI	GATC	6 cut(s)	111, 197, 549, 600, 660, 711
MboI	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
MboII	GAAGA	1 cut(s)	304
MflI	RGATCY	2 cut(s)	547, 658
MluCI	AATT	6 cut(s)	19, 93, 244, 385, 392, 513
MlyI	GAGTC	3 cut(s)	581, 585, 692
MnlI	CCTC	4 cut(s)	71, 129, 220, 472
MseI	TTAA	2 cut(s)	153, 243
MspA1I	CMGCKG	3 cut(s)	332, 578, 689
MspI	CCGG	2 cut(s)	554, 665
MspR9I	CCNGG	1 cut(s)	462
MvaI	CCWGG	1 cut(s)	462
MwoI	GCNNNNNNNGC	1 cut(s)	494
NdeII	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
NlaIII	CATG	6 cut(s)	116, 383, 408, 512, 541, 652
NlaIV	GGNNCC	1 cut(s)	160
NmeAIII	GCCGAG	1 cut(s)	491
NmuCI	GTSAC	1 cut(s)	608
NsbI	TGCGCA	1 cut(s)	222
NspI	RCATGY	2 cut(s)	541, 652
NspV	TTCGAA	1 cut(s)	44
PceI	AGGCCT	1 cut(s)	209
PfeI	GAWTC	2 cut(s)	41, 362
PflFI	GACNNNGTC	2 cut(s)	571, 682
PkrI	GCNGC	2 cut(s)	580, 691
PleI	GAGTC	3 cut(s)	580, 585, 691
PpsI	GAGTC	3 cut(s)	580, 585, 691
PsiI	TTATAA	1 cut(s)	518
Psp6I	CCWGG	1 cut(s)	460
PspGI	CCWGG	1 cut(s)	460
PspN4I	GGNNCC	1 cut(s)	160
PspPI	GGNCC	3 cut(s)	99, 556, 667
PstI	CTGCAG	1 cut(s)	273
PsuI	RGATCY	2 cut(s)	547, 658
PsyI	GACNNNGTC	2 cut(s)	571, 682
PvuII	CAGCTG	3 cut(s)	332, 578, 689
RsaI	GTAC	3 cut(s)	51, 258, 439
RsaNI	GTAC	3 cut(s)	50, 257, 438
SalI	GTCGAC	3 cut(s)	530, 588, 641
SaqAI	TTAA	2 cut(s)	153, 243
SatI	GCNGC	2 cut(s)	579, 690
Sau3AI	GATC	6 cut(s)	109, 195, 547, 598, 658, 709
Sau96I	GGNCC	3 cut(s)	99, 556, 667
SchI	GAGTC	3 cut(s)	581, 585, 692
ScrFI	CCNGG	1 cut(s)	462
SfaNI	GCATC	1 cut(s)	475
SfcI	CTRYAG	1 cut(s)	269
SfuI	TTCGAA	1 cut(s)	44
SinI	GGWCC	2 cut(s)	556, 667
SpeI	ACTAGT	1 cut(s)	454
Sse9I	AATT	6 cut(s)	19, 93, 244, 385, 392, 513
SseBI	AGGCCT	1 cut(s)	209
SspMI	CTAG	2 cut(s)	321, 455
StuI	AGGCCT	1 cut(s)	209
StyD4I	CCNGG	1 cut(s)	460
StyI	CCWWGG	1 cut(s)	162
TaaI	ACNGT	5 cut(s)	253, 587, 698, 724, 734
TaiI	ACGT	2 cut(s)	51, 493
TaqI	TCGA	5 cut(s)	44, 531, 589, 642, 766
TasI	AATT	6 cut(s)	19, 93, 244, 385, 392, 513
TfiI	GAWTC	2 cut(s)	41, 362
Tru1I	TTAA	2 cut(s)	153, 243
Tru9I	TTAA	2 cut(s)	153, 243
TscAI	CASTG	2 cut(s)	205, 481
TseFI	GTSAC	1 cut(s)	608
TseI	GCWGC	2 cut(s)	578, 689
Tsp45I	GTSAC	1 cut(s)	608
TspDTI	ATGAA	2 cut(s)	396, 740
TspGWI	ACGGA	2 cut(s)	584, 695
TspRI	CASTG	2 cut(s)	205, 481
Tth111I	GACNNNGTC	2 cut(s)	571, 682
VpaK11BI	GGWCC	2 cut(s)	556, 667
XapI	RAATTY	3 cut(s)	19, 93, 385
XceI	RCATGY	2 cut(s)	541, 652
XmiI	GTMKAC	4 cut(s)	531, 589, 642, 716
XspI	CTAG	2 cut(s)	321, 455

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.