RchiOBHm_Chr4g0416901

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
42066803 .. 42068842
2040 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38699

Sequence Viewer

Length: 225 bp
ATGATGAACTCCATGTTAATATTGGTTGGGGATTTCAAGTTTCCAAAGCATGATACTGCAATAAAGATGCCTCTCGGAATAGTTCCTGCAAGTTTGATACTCTTGATCTCTCAATTTTATATTTTGCAGTACTTTTGTTTGATAAGTTTGAAACCTTTAAAGTCCTGGAAGTTTAAACATCTCATTTCTTATGTTCTATCCCACAGGTTTGATCGATACTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.71

Weight (kDa)

9.78

Isoelectric Point (pI)

32.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 131
AgsI TTSAA 2 cut(s) 37, 151
AjnI CCWGG 1 cut(s) 164
BciT130I CCWGG 1 cut(s) 166
BmcAI AGTACT 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 166
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 1 cut(s) 57
Bsa29I ATCGAT 1 cut(s) 214
BseBI CCWGG 1 cut(s) 166
BseCI ATCGAT 1 cut(s) 214
BshVI ATCGAT 1 cut(s) 214
Bsp143I GATC 2 cut(s) 105, 211
BspDI ATCGAT 1 cut(s) 214
BssMI GATC 2 cut(s) 105, 211
Bst2UI CCWGG 1 cut(s) 166
BstKTI GATC 2 cut(s) 108, 214
BstMBI GATC 2 cut(s) 105, 211
BstNI CCWGG 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 164
Bsu15I ATCGAT 1 cut(s) 214
BsuTUI ATCGAT 1 cut(s) 214
ClaI ATCGAT 1 cut(s) 214
Csp6I GTAC 1 cut(s) 130
CviAII CATG 2 cut(s) 13, 50
CviQI GTAC 1 cut(s) 130
DpnI GATC 2 cut(s) 107, 213
DpnII GATC 2 cut(s) 105, 211
DraI TTTAAA 2 cut(s) 159, 175
EcoRII CCWGG 1 cut(s) 164
FaeI CATG 2 cut(s) 16, 53
FaiI YATR 4 cut(s) 14, 51, 120, 192
FatI CATG 2 cut(s) 12, 49
Hin1II CATG 2 cut(s) 16, 53
Hpy188I TCNGA 1 cut(s) 77
Hpy188III TCNNGA 2 cut(s) 103, 222
HpyCH4V TGCA 3 cut(s) 59, 89, 127
Hsp92II CATG 2 cut(s) 16, 53
Kzo9I GATC 2 cut(s) 105, 211
LpnPI CCDG 4 cut(s) 99, 151, 178, 190
LweI GCATC 1 cut(s) 57
MalI GATC 2 cut(s) 107, 213
MboI GATC 2 cut(s) 105, 211
MluCI AATT 1 cut(s) 113
MnlI CCTC 1 cut(s) 81
MseI TTAA 3 cut(s) 17, 158, 174
MspR9I CCNGG 1 cut(s) 166
MssI GTTTAAAC 1 cut(s) 175
MvaI CCWGG 1 cut(s) 166
NdeII GATC 2 cut(s) 105, 211
NlaIII CATG 2 cut(s) 16, 53
PfoI TCCNGGA 1 cut(s) 164
PmeI GTTTAAAC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
SaqAI TTAA 3 cut(s) 17, 158, 174
Sau3AI GATC 2 cut(s) 105, 211
ScaI AGTACT 1 cut(s) 131
ScrFI CCNGG 1 cut(s) 166
SetI ASST 2 cut(s) 157, 209
SfaNI GCATC 1 cut(s) 57
Sse9I AATT 1 cut(s) 113
SspI AATATT 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 164
TaqI TCGA 1 cut(s) 214
TasI AATT 1 cut(s) 113
TatI WGTACW 1 cut(s) 129
Tru1I TTAA 3 cut(s) 17, 158, 174
Tru9I TTAA 3 cut(s) 17, 158, 174
TspDTI ATGAA 1 cut(s) 20
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
ZrmI AGTACT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.