Rroxscaffold_5G00339470

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
7929462 .. 7931209
1748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00339470.1

Sequence Viewer

Length: 276 bp
ATGGGACTCGACTGTGGATTGCATAAAGCTCTGTCTCTCGACACAACCAAGATAAGGTTTAGGCCTTTAGGGGAAACAGTAGAGGATGTAGCATACAGTTGGTTATATGAGTTGGTGAAGAGGCATGTGGTTCAAGTTGGAGAACATAGATCTTGCGTATTTGCTGGGTCTTCCTATTCGGGTTATTCTCTAGATATTGGGAAAGAGCATGTAAATCTCATTGATCAAAGGCTGGAAAAGCTGATATACGGTGGGCGCTTGATGCAAAGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.37

Weight (kDa)

7.82

Isoelectric Point (pI)

22.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 2 cut(s) 29, 241
AluI AGCT 2 cut(s) 29, 241
Alw26I GTCTC 1 cut(s) 39
AoxI GGCC 1 cut(s) 62
AspLEI GCGC 1 cut(s) 258
AsuHPI GGTGA 1 cut(s) 127
BbsI GAAGAC 1 cut(s) 162
BclI TGATCA 1 cut(s) 223
BcoDI GTCTC 1 cut(s) 39
BfaI CTAG 2 cut(s) 191, 274
BfoI RGCGCY 1 cut(s) 259
BglII AGATCT 1 cut(s) 149
BmsI GCATC 1 cut(s) 252
BpiI GAAGAC 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 54
BseYI CCCAGC 1 cut(s) 164
BshFI GGCC 1 cut(s) 64
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 39
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 1 cut(s) 64
Bsp143I GATC 2 cut(s) 149, 223
BspANI GGCC 1 cut(s) 64
BssMI GATC 2 cut(s) 149, 223
Bst4CI ACNGT 4 cut(s) 14, 79, 98, 251
Bst6I CTCTTC 1 cut(s) 113
BstF5I GGATG 1 cut(s) 91
BstH2I RGCGCY 1 cut(s) 259
BstHHI GCGC 1 cut(s) 258
BstKTI GATC 2 cut(s) 152, 226
BstMAI GTCTC 1 cut(s) 39
BstMBI GATC 2 cut(s) 149, 223
BstMWI GCNNNNNNNGC 2 cut(s) 238, 262
BstNSI RCATGY 2 cut(s) 128, 212
BstV2I GAAGAC 1 cut(s) 162
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BsuRI GGCC 1 cut(s) 64
BtsCI GGATG 1 cut(s) 91
CfoI GCGC 1 cut(s) 258
CviAII CATG 2 cut(s) 125, 209
CviJI RGCY 4 cut(s) 29, 64, 232, 241
CviKI_1 RGCY 4 cut(s) 29, 64, 232, 241
DpnI GATC 2 cut(s) 151, 225
DpnII GATC 2 cut(s) 149, 223
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco147I AGGCCT 1 cut(s) 64
FaeI CATG 2 cut(s) 128, 212
FaiI YATR 8 cut(s) 24, 94, 106, 108, 126, 147, 210, 247
FaqI GGGAC 1 cut(s) 18
FatI CATG 2 cut(s) 124, 208
FbaI TGATCA 1 cut(s) 223
FokI GGATG 1 cut(s) 98
FspBI CTAG 2 cut(s) 191, 274
GlaI GCGC 1 cut(s) 257
GsaI CCCAGC 1 cut(s) 168
HaeII RGCGCY 1 cut(s) 259
HaeIII GGCC 1 cut(s) 64
HhaI GCGC 1 cut(s) 258
Hin1II CATG 2 cut(s) 128, 212
Hin6I GCGC 1 cut(s) 256
HinP1I GCGC 1 cut(s) 256
HinfI GANTC 1 cut(s) 6
HphI GGTGA 1 cut(s) 127
Hpy188III TCNNGA 2 cut(s) 38, 191
HpyCH4III ACNGT 4 cut(s) 14, 79, 98, 251
HpyCH4V TGCA 2 cut(s) 22, 265
HpyF10VI GCNNNNNNNGC 2 cut(s) 238, 262
Hsp92II CATG 2 cut(s) 128, 212
HspAI GCGC 1 cut(s) 256
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 149, 223
LpnPI CCDG 2 cut(s) 150, 218
LweI GCATC 1 cut(s) 252
MaeI CTAG 2 cut(s) 191, 274
MalI GATC 2 cut(s) 151, 225
MboI GATC 2 cut(s) 149, 223
MboII GAAGA 2 cut(s) 130, 162
MflI RGATCY 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 2 cut(s) 76, 114
MwoI GCNNNNNNNGC 2 cut(s) 238, 262
NdeII GATC 2 cut(s) 149, 223
NlaIII CATG 2 cut(s) 128, 212
NspI RCATGY 2 cut(s) 128, 212
PceI AGGCCT 1 cut(s) 64
PspFI CCCAGC 1 cut(s) 164
PsuI RGATCY 1 cut(s) 149
Sau3AI GATC 2 cut(s) 149, 223
SetI ASST 3 cut(s) 31, 59, 243
SfaNI GCATC 1 cut(s) 252
SseBI AGGCCT 1 cut(s) 64
SspMI CTAG 2 cut(s) 191, 274
StuI AGGCCT 1 cut(s) 64
TaaI ACNGT 4 cut(s) 14, 79, 98, 251
TaqI TCGA 2 cut(s) 9, 39
XbaI TCTAGA 1 cut(s) 190
XceI RCATGY 2 cut(s) 128, 212
XspI CTAG 2 cut(s) 191, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.