RLG00000034064

Protein of unknown function (DUF3675)

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Reverse (-)
36189078 .. 36190161
1084 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000034064

Sequence Viewer

Length: 402 bp
ATGCCTCTCGGAATAGTTCCTGCAAGTTTGATACTCTTGATCTCTCAATTATATATTTTGCAGTACTTTTGTTTGATAAGTTTGAAACCTTTAAAGTCCTGGAAGTTTAAACATCTCATTTCTTATGTTCTATCCCACAGGTTTGATACTCTTGATTTCTATTATGCTCATATAAAATGTGTCCAGAGGTGGTGCAATGAGAAGGGAGATATCATTTATGAAATCTGTCATCAGCCTTATCAACCTGGTTATACTGCCCCATCACCTCCCCCTCAGTTTGACGACACTACTATTGACATCAGGCCAATATGGTGTAGACCTTGTCTGTTTTGTAGCTCTTTTGGAGTGAAAACTCAATTAAGCTACCAAAAGGCAGAAGTTAGAAGGAGGTCACTGGCATAA

Protein Analysis

134

Amino Acids

15.59

Weight (kDa)

8.99

Isoelectric Point (pI)

60.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 316
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 85
AjnI CCWGG 2 cut(s) 98, 244
AluBI AGCT 2 cut(s) 336, 363
AluI AGCT 2 cut(s) 336, 363
AoxI GGCC 1 cut(s) 302
AsuHPI GGTGA 1 cut(s) 255
BccI CCATC 1 cut(s) 268
BciT130I CCWGG 2 cut(s) 100, 246
BmcAI AGTACT 1 cut(s) 65
Bme1390I CCNGG 2 cut(s) 100, 246
BmrFI CCNGG 2 cut(s) 100, 246
Bse1I ACTGG 1 cut(s) 399
Bse3DI GCAATG 1 cut(s) 202
BseBI CCWGG 2 cut(s) 100, 246
BseMI GCAATG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 287
BseNI ACTGG 1 cut(s) 399
BshFI GGCC 1 cut(s) 304
BsnI GGCC 1 cut(s) 304
Bsp143I GATC 1 cut(s) 39
BspANI GGCC 1 cut(s) 304
BspCNI CTCAG 1 cut(s) 286
BsrDI GCAATG 1 cut(s) 202
BsrI ACTGG 1 cut(s) 399
BssMI GATC 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 100, 246
BstDEI CTNAG 1 cut(s) 273
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstNI CCWGG 2 cut(s) 100, 246
BstSCI CCNGG 2 cut(s) 98, 244
BsuRI GGCC 1 cut(s) 304
BtsIMutI CAGTG 1 cut(s) 392
CsiI ACCWGGT 1 cut(s) 244
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 4 cut(s) 235, 304, 336, 363
CviKI_1 RGCY 4 cut(s) 235, 304, 336, 363
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 1 cut(s) 273
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
DraI TTTAAA 2 cut(s) 93, 109
Eco32I GATATC 1 cut(s) 211
EcoRII CCWGG 2 cut(s) 98, 244
EcoRV GATATC 1 cut(s) 211
FblI GTMKAC 1 cut(s) 316
HaeIII GGCC 1 cut(s) 304
HphI GGTGA 1 cut(s) 255
Hpy166II GTNNAC 1 cut(s) 317
Hpy188I TCNGA 1 cut(s) 11
Hpy188III TCNNGA 3 cut(s) 37, 152, 184
Hpy8I GTNNAC 1 cut(s) 317
HpyAV CCTTC 2 cut(s) 196, 378
HpyCH4V TGCA 3 cut(s) 23, 61, 195
HpyF3I CTNAG 1 cut(s) 273
Kzo9I GATC 1 cut(s) 39
LpnPI CCDG 9 cut(s) 33, 85, 112, 124, 197, 231, 258, 286, 380
MabI ACCWGGT 1 cut(s) 244
MaeIII GTNAC 1 cut(s) 390
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MluCI AATT 2 cut(s) 47, 356
MnlI CCTC 5 cut(s) 15, 180, 276, 282, 381
MseI TTAA 3 cut(s) 92, 108, 359
MspR9I CCNGG 2 cut(s) 100, 246
MssI GTTTAAAC 1 cut(s) 109
MvaI CCWGG 2 cut(s) 100, 246
NdeII GATC 1 cut(s) 39
NmuCI GTSAC 1 cut(s) 390
PflFI GACNNNGTC 1 cut(s) 321
PfoI TCCNGGA 1 cut(s) 98
PmeI GTTTAAAC 1 cut(s) 109
Psp6I CCWGG 2 cut(s) 98, 244
PspGI CCWGG 2 cut(s) 98, 244
PsyI GACNNNGTC 1 cut(s) 321
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 3 cut(s) 92, 108, 359
Sau3AI GATC 1 cut(s) 39
ScaI AGTACT 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 100, 246
SetI ASST 9 cut(s) 91, 143, 191, 247, 268, 322, 338, 365, 392
SexAI ACCWGGT 1 cut(s) 244
Sse9I AATT 2 cut(s) 47, 356
StyD4I CCNGG 2 cut(s) 98, 244
TasI AATT 2 cut(s) 47, 356
TatI WGTACW 1 cut(s) 63
Tru1I TTAA 3 cut(s) 92, 108, 359
Tru9I TTAA 3 cut(s) 92, 108, 359
TscAI CASTG 1 cut(s) 399
TseFI GTSAC 1 cut(s) 390
Tsp45I GTSAC 1 cut(s) 390
TspDTI ATGAA 1 cut(s) 234
TspRI CASTG 1 cut(s) 399
Tth111I GACNNNGTC 1 cut(s) 321
XmiI GTMKAC 1 cut(s) 316
ZrmI AGTACT 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.