Rw1G019930

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
43233948 .. 43234331
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G019930.1

Sequence Viewer

Length: 384 bp
ATGATGAACTCCATGTTAATATTGGTTGGGGATTTCAAGTTTCCAAAGCATAGAGTGATTGATCCCAGAGAGAAAATTTCTGCCATGGGATTGCAAACTATATTCTCACAGGGGATCAAGTCTGATATATCATTGTGTGTGTGTGTGTGTGATCTCTCAATTATATATTTTGCAGTACTTTTGTTTGATAAGTTTGAAACCTTTAAAGTCCTGGAAGCAGTACTTTTGTTTGATAAGTTTGAAACCTTTAAAGTTGTCTTGAAGATACATGTGCATATATTAAGCTCATTGTGTGTGTGTGTGTTAATTTGTCTTGAAGATACATGTGCATATATTAAGCTCATTTTGTGTGTGTGTGTGTGTGTGTGTGTTAATTTGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.35

Weight (kDa)

6.78

Isoelectric Point (pI)

15.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 56, 122
AcsI RAATTY 1 cut(s) 75
AfaI GTAC 2 cut(s) 177, 222
AflIII ACRYGT 2 cut(s) 268, 323
AgsI TTSAA 5 cut(s) 37, 197, 242, 262, 317
AjnI CCWGG 1 cut(s) 210
AluBI AGCT 2 cut(s) 285, 340
AluI AGCT 2 cut(s) 285, 340
AlwI GGATC 2 cut(s) 56, 122
ApoI RAATTY 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 212
BmcAI AGTACT 2 cut(s) 177, 222
Bme1390I CCNGG 1 cut(s) 212
BmrFI CCNGG 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 1 cut(s) 84
Bsp143I GATC 3 cut(s) 61, 114, 151
Bsp19I CCATGG 1 cut(s) 84
BspPI GGATC 2 cut(s) 56, 122
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 3 cut(s) 61, 114, 151
BssT1I CCWWGG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 212
BstDSI CCRYGG 1 cut(s) 84
BstKTI GATC 3 cut(s) 64, 117, 154
BstMBI GATC 3 cut(s) 61, 114, 151
BstNI CCWGG 1 cut(s) 212
BstNSI RCATGY 2 cut(s) 272, 327
BstSCI CCNGG 1 cut(s) 210
BtgI CCRYGG 1 cut(s) 84
Csp6I GTAC 2 cut(s) 176, 221
CviAII CATG 4 cut(s) 13, 85, 269, 324
CviJI RGCY 2 cut(s) 285, 340
CviKI_1 RGCY 2 cut(s) 285, 340
CviQI GTAC 2 cut(s) 176, 221
DpnI GATC 3 cut(s) 63, 116, 153
DpnII GATC 3 cut(s) 61, 114, 151
DraI TTTAAA 2 cut(s) 205, 250
Eco130I CCWWGG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 84
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 4 cut(s) 16, 88, 272, 327
FalI AAGNNNNNCTT 2 cut(s) 207, 239
FatI CATG 4 cut(s) 12, 84, 268, 323
Hin1II CATG 4 cut(s) 16, 88, 272, 327
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 3 cut(s) 259, 314, 381
HpyCH4V TGCA 4 cut(s) 94, 173, 274, 329
Hsp92II CATG 4 cut(s) 16, 88, 272, 327
Kzo9I GATC 3 cut(s) 61, 114, 151
LpnPI CCDG 4 cut(s) 79, 95, 197, 224
MalI GATC 3 cut(s) 63, 116, 153
MboI GATC 3 cut(s) 61, 114, 151
MboII GAAGA 2 cut(s) 274, 329
MluCI AATT 4 cut(s) 75, 159, 306, 373
MseI TTAA 7 cut(s) 17, 204, 249, 281, 305, 336, 372
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
NcoI CCATGG 1 cut(s) 84
NdeII GATC 3 cut(s) 61, 114, 151
NlaIII CATG 4 cut(s) 16, 88, 272, 327
NspI RCATGY 2 cut(s) 272, 327
PciI ACATGT 2 cut(s) 268, 323
PfoI TCCNGGA 1 cut(s) 210
PscI ACATGT 2 cut(s) 268, 323
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
RsaI GTAC 2 cut(s) 177, 222
RsaNI GTAC 2 cut(s) 176, 221
SaqAI TTAA 7 cut(s) 17, 204, 249, 281, 305, 336, 372
Sau3AI GATC 3 cut(s) 61, 114, 151
ScaI AGTACT 2 cut(s) 177, 222
ScrFI CCNGG 1 cut(s) 212
SetI ASST 4 cut(s) 203, 248, 287, 342
Sse9I AATT 4 cut(s) 75, 159, 306, 373
SspI AATATT 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 84
TasI AATT 4 cut(s) 75, 159, 306, 373
TatI WGTACW 2 cut(s) 175, 220
Tru1I TTAA 7 cut(s) 17, 204, 249, 281, 305, 336, 372
Tru9I TTAA 7 cut(s) 17, 204, 249, 281, 305, 336, 372
TspDTI ATGAA 1 cut(s) 20
XapI RAATTY 1 cut(s) 75
XceI RCATGY 2 cut(s) 272, 327
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
ZrmI AGTACT 2 cut(s) 177, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.