RLG00000014520

Protein of unknown function (DUF3675)

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Forward (+)
54311435 .. 54312518
1084 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014520

Sequence Viewer

Length: 387 bp
ATGCCTCTCGGAATAGTTCCTGCAAGTTTGATACTCTTGATCTCTCAATTATATATTTTGCAGTACTTTTGTTTGATAAGTTTGAAACCTTTAAAGTCCTGGAAGTTTAAACATCTCATTTCTTATGTTCTATCCCACAGGTTTGATACTCTTGATTTCTATTATGCTCATATAAAATGTGTCCAGAGGTGGTGCAATGAAAAGGGAGATATCATTTATGAAATCTGTCATCAGCCTTATCAACCTGGTTATACTGCCCCATCACCTCCCCCTCAGTTTGACGACACTACTATTGACATCAGGCAAGTTCACAATTTACATAGGCCTTTTAACTCAGTTAATATTGCTACTATGGGATTTTTTTTTCCTTTTGGTTTTTCAGAATAA

Protein Analysis

129

Amino Acids

15.0

Weight (kDa)

7.72

Isoelectric Point (pI)

58.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 1 cut(s) 85
AjnI CCWGG 2 cut(s) 98, 244
AoxI GGCC 1 cut(s) 323
AsuHPI GGTGA 1 cut(s) 255
BccI CCATC 1 cut(s) 268
BciT130I CCWGG 2 cut(s) 100, 246
BmcAI AGTACT 1 cut(s) 65
Bme1390I CCNGG 2 cut(s) 100, 246
BmrFI CCNGG 2 cut(s) 100, 246
Bse3DI GCAATG 1 cut(s) 202
BseBI CCWGG 2 cut(s) 100, 246
BseMI GCAATG 1 cut(s) 202
BseMII CTCAG 2 cut(s) 287, 348
BshFI GGCC 1 cut(s) 325
BsnI GGCC 1 cut(s) 325
Bsp143I GATC 1 cut(s) 39
BspANI GGCC 1 cut(s) 325
BspCNI CTCAG 2 cut(s) 286, 347
BsrDI GCAATG 1 cut(s) 202
BssMI GATC 1 cut(s) 39
Bst2UI CCWGG 2 cut(s) 100, 246
BstDEI CTNAG 2 cut(s) 273, 334
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstNI CCWGG 2 cut(s) 100, 246
BstSCI CCNGG 2 cut(s) 98, 244
BsuRI GGCC 1 cut(s) 325
CsiI ACCWGGT 1 cut(s) 244
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 2 cut(s) 235, 325
CviKI_1 RGCY 2 cut(s) 235, 325
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 2 cut(s) 273, 334
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
DraI TTTAAA 2 cut(s) 93, 109
Eco147I AGGCCT 1 cut(s) 325
Eco32I GATATC 1 cut(s) 211
EcoRII CCWGG 2 cut(s) 98, 244
EcoRV GATATC 1 cut(s) 211
HaeIII GGCC 1 cut(s) 325
HphI GGTGA 1 cut(s) 255
Hpy166II GTNNAC 1 cut(s) 310
Hpy188I TCNGA 2 cut(s) 11, 382
Hpy188III TCNNGA 3 cut(s) 37, 152, 184
Hpy8I GTNNAC 1 cut(s) 310
HpyCH4V TGCA 3 cut(s) 23, 61, 195
HpyF3I CTNAG 2 cut(s) 273, 334
Kzo9I GATC 1 cut(s) 39
LpnPI CCDG 8 cut(s) 33, 85, 112, 124, 197, 231, 258, 286
MabI ACCWGGT 1 cut(s) 244
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MluCI AATT 2 cut(s) 47, 313
MnlI CCTC 4 cut(s) 15, 180, 276, 282
MseI TTAA 4 cut(s) 92, 108, 330, 339
MspR9I CCNGG 2 cut(s) 100, 246
MssI GTTTAAAC 1 cut(s) 109
MvaI CCWGG 2 cut(s) 100, 246
NdeII GATC 1 cut(s) 39
PceI AGGCCT 1 cut(s) 325
PfoI TCCNGGA 1 cut(s) 98
PmeI GTTTAAAC 1 cut(s) 109
Psp6I CCWGG 2 cut(s) 98, 244
PspGI CCWGG 2 cut(s) 98, 244
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 4 cut(s) 92, 108, 330, 339
Sau3AI GATC 1 cut(s) 39
ScaI AGTACT 1 cut(s) 65
ScrFI CCNGG 2 cut(s) 100, 246
SetI ASST 5 cut(s) 91, 143, 191, 247, 268
SexAI ACCWGGT 1 cut(s) 244
Sse9I AATT 2 cut(s) 47, 313
SseBI AGGCCT 1 cut(s) 325
SspI AATATT 1 cut(s) 343
StuI AGGCCT 1 cut(s) 325
StyD4I CCNGG 2 cut(s) 98, 244
TasI AATT 2 cut(s) 47, 313
TatI WGTACW 1 cut(s) 63
Tru1I TTAA 4 cut(s) 92, 108, 330, 339
Tru9I TTAA 4 cut(s) 92, 108, 330, 339
TspDTI ATGAA 2 cut(s) 213, 234
ZrmI AGTACT 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.